p53 AIP1 (TP53AIP1) (NM_022112) Human Untagged Clone

CAT#: SC304994

TP53AIP1 (untagged)-Human tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TP53AIP1
• Synonyms: P53AIP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022112, the custom clone sequence may differ by one or more nucleotides
  ATGGGATCTTCCTCTGAGGCGAGCTTCAGATCTGCTCAAGCTTCCTGCAGTGGGGCCAGG
  AGGCAGGGCCTGGGCAGGGGAGACCAGAACCTCTCGGTGATGCCTCCGAATGGCAGGGCT
  CAGACACACACACCTGGCTGGGTAAGTCCCTGCAGTGAAAACCGAGACGGTCTTTTGCCT
  GCCACAGCCCCGGGCAGACTCTGCTCTCACCGTGGTGCCGACATCCCAAGTTTTCAGACT
  CACCAGGACCCAGTGACAGCATCTGGGTCCTCAGAGCTGCATGCGGACTGTCCCCAGTTC
  AGAGCATTGGACAGAGCTGGGAACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_022112
• ORF Size: 1278 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022112.1, NP_071395.1
• RefSeq Size: 2659
• RefSeq ORF: 1278
• Locus ID: 63970
• Protein Families: Druggable Genome
• Protein Pathways: p53 signaling pathway
• Gene Summary: This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the longest isoform (a).