KCNK7 (NM_033348) Human Untagged Clone

CAT#: SC305619

KCNK7 (untagged)-Human potassium channel, subfamily K, member 7 (KCNK7), transcript variant B


  "NM_033348" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNK7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNK7
Synonyms K2p7.1; TWIK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033348, the custom clone sequence may differ by one or more nucleotides


ATGGGGGGTCTAAGGCCCTGGTCCCGATACGGGCTCCTGGTTGTGGCCCACTTGCTGGCCCTGGGGCTTG
GGGCTGTGGTGTTCCAGGCCCTGGAGGGGCCTCCTGCATGCAGGCTTCAGGCTGAGCTCAGGGCAGAGCT
GGCAGCCTTCCAGGCAGAGCATAGGGCCTGCCTGCCACCCGGAGCTCTGGAAGAGCTGCTGGGCACTGCC
CTGGCCACCCAGGCCCATGGGGTCTCCACCCTGGGCAACAGCTCAGAGGGCAGGACCTGGGACCTTCCCT
CAGCCCTGCTCTTCGCTGCCAGCATCCTCACCACCACAGGTTATGGCCACATGGCCCCACTATCGCCAGG
CGGAAAGGCCTTCTGCATGGTCTATGCAGCCCTGGGGCTGCCAGCCTCCTTAGCTCTCGTGGCCACCCTG
CGCCATTGCCTGCTGCCTGTGCTCAGCCGCCCACGTGCCTGGGTAGCGGTCCACTGGCAGCTGTCACCGG
CCAGGGCTGCGCTGCTGCAGGCAGTTGCACTGGGACTGCTGGTGGCCAGCAGCTTTGTGCTGCTGCCAGC
GCTGGTGCTGTGGGGCCTTCAGGGCGACTGCAGCCTGCTGGGGGCCGTCTACTTCTGCTTCAGCTCGCTC
AGCACCATTGGCCTGGAGGACTTGCTGCCCGGCCGCGGCCGCAGCCTGCACCCCGTGATTTACCACCTGG
GCCAGCTCGCACTTCTTGGTGGAGGGACCTCACTCCAGGGCACGGCGTGGGAGGGGTAG


Restriction Sites SgfI-MluI     
ACCN NM_033348
ORF Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033348.1, NP_203134.1
RefSeq Size 1388
RefSeq ORF 759
Locus ID 10089
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (B) has an additional exon in the 3' region, compared to variant A. The resulting isoform (B) is shorter and has a distinct C-terminus, compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.