EPT1 (SELENOI) (NM_033505) Human Untagged Clone
CAT#: SC305647
EPT1 (untagged)-Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
"NM_033505" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Symbol | SELENOI |
Synonyms | EPT1; SELI; SEPI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_033505, the custom clone sequence may differ by one or more nucleotides
ATGGCTGGCTACGAATACGTGAGCCCGGAGCAGCTGGCTGGCTTTGATAAGTACAAGTACAGTGCTGTGG ATACCAATCCACTTTCTCTGTATGTCATGCATCCATTCTGGAACACTATAGTAAAGGTATTTCCTACTTG GCTGGCGCCCAATCTGATAACTTTTTCTGGCTTTCTGCTGGTCGTATTCAATTTTCTGCTAATGGCATAC TTTGATCCTGACTTTTATGCCTCAGCACCAGGTCACAAGCACGTGCCTGACTGGGTTTGGATTGTAGTGG GCATCCTCAACTTCGTAGCCTACACTCTAGATGGTGTGGACGGAAAGCAAGCTCGCAGAACCAATTCTAG CACTCCCTTAGGGGAGCTTTTTGATCATGGCCTGGATAGTTGGTCATGTGTTTACTTTGTTGTGACTGTT TATTCCATCTTTGGAAGAGGATCAACTGGTGTCAGTGTTTTTGTTCTTTATCTCCTGCTATGGGTAGTTT TGTTTTCTTTCATCCTGTCCCACTGGGAAAAGTATAACACAGGGATTCTTTTCCTGCCATGGGGATATGA CATTAGCCAGGTGACTATTTCTTTTGTCTACATAGTGACTGCAGTTGTGGGAGTTGAGGCCTGGTATGAA CCTTTCCTGTTTAATTTCTTATATAGAGACCTATTCACTGCAATGATTATTGGTTGTGCATTATGTGTGA CTCTTCCAATGAGTTTATTAAACTTTTTCAGAAGCTATAAAAATAACACCTTGAAACTCAATTCAGTCTA TGAAGCTATGGTTCCCTTATTTTCTCCATGCTTGCTGTTCATTTTGTCTACAGCGTGGATCCTTTGGTCA CCTTCAGATATTTTAGAGCTACATCCTAGAGTATTCTACTTTATGGTTGGAACAGCTTTTGCCAACAGTA CATGTCAGCTGATTGTTTGCCAAATGAGTAGTACCCGGTGTCCAACTTTGAATTGGTTGCTGGTTCCTCT CTTCTTGGTTGTCTTAGTGGTAAACCTAGGAGTAGCCTCTTACGTTGAGAGCATTCTCCTGTATACATTA ACAACTGCTTTTACTCTGGCCCACATCCATTATGGAGTACGAGTGGTAAAGCAGCTGAGCAGCCATTTTC AGATTTACCCCTTCTCATTGAGGAAACCAAACTCAGATTGACTAGGAATGGAAGAAAAGAATATTGGCCT GTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033505 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Reference Data | |
RefSeq | NM_033505.3, NP_277040.1 |
RefSeq Size | 8143 |
Locus ID | 85465 |
Gene Summary | The multi-pass transmembrane protein encoded by this gene belongs to the CDP-alcohol phosphatidyltransferase class-I family. It catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine, which is involved in the formation and maintenance of vesicular membranes, regulation of lipid metabolism, and protein folding. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) represents the selenoprotein-encoding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216434 | EPT1 (Myc-DDK-tagged)-Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (Note, selenocysteine protein, internal stop codon, see reference data summary) |
USD 420.00 |
|
RG216434 | EPT1 (GFP-tagged) - Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 460.00 |
|
RC216434L1 | Lenti-ORF, EPT1 (Myc-DDK-tagged)-Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (Note, selenocystein protein, internal stop codon, see summary) |
USD 768.00 |
|
RC216434L2 | Lenti-ORF, EPT1 (mGFP-tagged) - Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (Note: selenocystein protein, Internal stop codon present. See Summary below) |
USD 620.00 |
|
RC216434L3 | Lenti-ORF, EPT1 (Myc-DDK-tagged)-Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (Note, selenocystein protein, internal stop codon, see summary) |
USD 620.00 |
|
RC216434L4 | Lenti-ORF, EPT1 (mGFP-tagged) - Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1), (Note: selenocystein protein, Internal stop codon present. See Summary below) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review