SPANXB2 (NM_145664) Human Untagged Clone
CAT#: SC306258
SPANXB2 (untagged)-Human SPANX family, member B2 (SPANXB2)
"NM_145664" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPANXB2 |
Synonyms | SPANX; SPANXB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145664, the custom clone sequence may differ by one or more nucleotides
ATGGGCCAACAATCCAGTGTCCGCAGGCTGAAGAGGAGCGTCCCCTGTGAATCCAACGAGGCCAACGAGG CCAATGAGGCCAACAAGACGATGCCGGAGACCCCAACTGGGGACTCAGACCCGCAACCTGCTCCTAAAAA AATGAAAACATCTGAGTCCTCGACCATACTAGTGGTTCGCTACAGGAGGAACGTGAAAAGAACATCTCCA GAGGAACTGGTGAATGACCACGCCCGAGAGAACAGAATCAACCCCGACCAAATGGAGGAGGAGGAATTCA TAGAAATAACGACTGAAAGACCTAAAAAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_145664 |
ORF Size | 312 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_145664.1, NP_663697.1 |
RefSeq Size | 469 |
RefSeq ORF | 312 |
Locus ID | 100133171 |
Gene Summary | Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-tail orientation with SPANX family member B1 and appears to be a duplication of that locus. The SPANXB genes are unique members of this gene family, since they contain an additional 18 nt in their coding region compared to the majority of family members. Although the protein encoded by this gene contains consensus nuclear localization signals, the major site for subcellular localization of expressed protein is in the cytoplasmic droplets of ejaculated spermatozoa. This protein provides a biochemical marker for studying the unique structures in spermatazoa, while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205245 | SPANXB2 (Myc-DDK-tagged)-Human SPANX family, member B2 (SPANXB2) |
USD 98.00 |
|
RG205245 | SPANXB2 (GFP-tagged) - Human SPANX family, member B2 (SPANXB2) |
USD 460.00 |
|
RC205245L3 | Lenti-ORF clone of SPANXB2 (Myc-DDK-tagged)-Human SPANX family, member B2 (SPANXB2) |
USD 620.00 |
|
RC205245L4 | Lenti-ORF clone of SPANXB2 (mGFP-tagged)-Human SPANX family, member B2 (SPANXB2) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review