Kallikrein 12 (KLK12) (NM_145895) Human Untagged Clone

CAT#: SC306289

KLK12 (untagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLK12
• Synonyms: KLK-L5; KLKL5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145895, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCTCAGCATCTTTTTGCTCCTGTGTGTTCTTGGGCTCAGCCAGGCAGCCACACCGAAGATTTTCA
  ATGGCACTGAGTGTGGGCGTAACTCACAGCCGTGGCAGGTGGGGCTGTTTGAGGGCACCAGCCTGCGCTG
  CGGGGGTGTCCTTATTGACCACAGGTGGGTCCTCACAGCGGCTCACTGCAGCGGCAGACCCATTCCCGGA
  TCTGCTCCAGTGCCTCAACCTCTCCATCGTCTCCCATGCCACCTGCCATGGTGTGTATCCCGGGAGAATC
  ACGAGCAACATGGTGTGTGCAGGCGGCGTCCCGGGGCAGGATGCCTGCCAGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_145895
• ORF Size: 336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_145895.1, NP_665902.1
• RefSeq Size: 814
• RefSeq ORF: 336
• Locus ID: 43849
• Protein Families: Druggable Genome, Protease, Secreted Protein
• Gene Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an exon in the coding region and uses alternate splice sites in the 3' coding region, compared to variant 1. Isoform 3 has a shorter and distinct C-terminus compared to isoform 1.