TMIE (NM_147196) Human Untagged Clone

CAT#: SC306309

TMIE (untagged)-Human transmembrane inner ear (TMIE)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMIE
• Synonyms: DFNB6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_147196, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGGTGGCCGGGCGCGGGTCCCCTCTGCGTGCTGGGCGGCGCCGCACTCGGGGTGTGCCTCGCGG
  GGGTTGCCGGGCAGCTGGTGGAGCCCAGCACGGCCCCACCCAAGCCCAAGCCGCCTCCGCTGACCAAGGA
  GACAGTGGTGTTCTGGGACATGCGCCTGTGGCACGTGGTGGGCATCTTTTCGCTCTTCGTGTTGTCCATC
  ATCATCACGCTGTGCTGTGTCTTCAACTGTCGTGTGCCACGGACCCGGAAGGAGATCGAAGCCCGGTACC
  TGCAGCGAAAGGCAGCCAAGATGTACACAGACAAGCTGGAGACTGTGCCACCCCTCAATGAGCTCACAGA
  AGTCCCAGGAGAGGATAAGAAGAAGAAGAAGAAGAAGAAGAAGGACAGTGTGGACACAGTGGCCATCAAA
  GTAGAGGAGGATGAGAAGAATGAGGCCAAGAAGAAGAAAGGAGAGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_147196
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_147196.2, NP_671729.2
• RefSeq Size: 1861
• RefSeq ORF: 471
• Locus ID: 259236
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009]