DEFB105A (NM_152250) Human Untagged Clone

CAT#: SC306355

DEFB105A (untagged)-Human defensin, beta 105A (DEFB105A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB105A
• Synonyms: BD-5; DEFB-5; DEFB105
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_152250, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCTGATCAGGAAGACATTTTATTTTCTATTTGCTATGTTCTTCATTTTGGTTCAACTGCCATCAG
  GGTGCCAGGCAGGACTTGATTTTTCCCAACCATTTCCATCAGGTGAGTTTGCTGTCTGTGAGTCGTGCAA
  GCTTGGTCGGGGAAAATGCAGGAAGGAGTGCTTGGAGAATGAGAAGCCCGATGGAAATTGCAGGCTGAAC
  TTTCTCTGCTGCAGACAGAGGATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_152250
• ORF Size: 237 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_152250.2, NP_689463.1
• RefSeq Size: 331
• RefSeq ORF: 237
• Locus ID: 245908
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 105, DEFB105A and DEFB105B, in tail-to-tail orientation. This gene, DEFB105A, represents the more centromeric copy. [provided by RefSeq, Oct 2014]