DEFB119 (NM_153289) Human Untagged Clone

CAT#: SC306581

DEFB119 (untagged)-Human defensin, beta 119 (DEFB119), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB119
• Synonyms: DEFB-19; DEFB-20; DEFB20; DEFB120; ESC42-RELA; ESC42-RELB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153289, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACTTCTTTACCTGTTTCTTGCCATCCTTCTGGCCATAGAAGAACCAGTGATATCAGGCAAACGCC
  ACATCCTTCGATGCATGGGTAACAGTGGAATTTGTAGGGCCTCTTGCAAAAAGAACGAACAGCCCTACCT
  CTATTGCAGAAATTGTCAGTCCTGCTGCCTCCAGTCCTACATGAGGATAAGCATTTCTGGCAAAGAGGAA
  AATACCGACTGGTCTTATGAGAAGCAGTGGCCAAGACTACCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153289
• ORF Size: 255 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153289.3, NP_695021.2
• RefSeq Size: 515
• RefSeq ORF: 255
• Locus ID: 245932
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (1) contains an alternate 3' exon, compared to variant 3 resulting in a different 3' coding region and 3' UTR. The encoded isoform (a) is shorter and has a distinct C-terminus, compared to isoform c.