TGIF (TGIF1) (NM_173207) Human Untagged Clone
CAT#: SC306805
TGIF1 (untagged)-Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2
"NM_173207" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TGIF1 |
Synonyms | HPE4; TGIF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173207, the custom clone sequence may differ by one or more nucleotides
ATGACTTGCTCGGGCAAAAGTTGTGCATTGGCCCGATCAAGCCTGACTTCTAGCCAAGGTATTGTTGCAG CATCTGGCAGTGAGACTGAGGATGAGGACAGCATGGACATTCCCTTGGACCTTTCTTCATCCGCTGGCTC AGGCAAGAGAAGGAGAAGGGGCAACCTACCCAAGGAGTCTGTGCAGATTCTTCGGGATTGGCTGTATGAG CACCGTTACAATGCCTATCCTTCAGAGCAAGAAAAAGCGTTGCTGTCCCAGCAAACACACCTGTCTACGC TACAGGTCTGTAACTGGTTCATCAACGCCCGCCGCAGGCTCCTCCCTGACATGCTGAGAAAGGATGGCAA AGATCCAAATCAGTTCACAATTTCCCGCCGTGGGGCCAAGATTTCTGAAACGAGCTCTGTGGAGTCCGTG ATGGGCATCAAAAACTTCATGCCAGCTCTAGAGGAGACCCCATTTCATTCCTGTACAGCTGGGCCAAACC CAACCCTAGGGAGGCCACTGTCTCCTAAGCCGTCATCCCCGGGATCAGTTTTGGCTCGTCCATCAGTGAT CTGCCATACCACTGTGACTGCATTGAAAGATGTCCCTTTCTCTCTCTGCCAGTCGGTCGGTGTGGGACAA AACACAGATATACAGCAGATAGCGGCCAAAAACTTCACAGACACCTCTCTCATGTACCCAGAGGACACTT GTAAATCTGGACCAAGTACGAATACACAGAGTGGTCTTTTCAACACTCCTCCCCCTACTCCACCGGACCT CAACCAGGACTTCAGTGGATTTCAGCTTCTAGTGGATGTTGCACTCAAACGGGCTGCAGAGATGGAGCTT CAGGCAAAACTTACAGCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173207 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173207.2, NP_775299.1 |
RefSeq Size | 1498 bp |
RefSeq ORF | 861 bp |
Locus ID | 7050 |
Cytogenetics | 18p11.31 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors |
Gene Summary | 'The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (2) has an alternate 5' terminal exon, which results in a different 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217799 | TGIF1 (Myc-DDK-tagged)-Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2 |
USD 420.00 |
|
RG217799 | TGIF1 (GFP-tagged) - Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2 |
USD 460.00 |
|
RC217799L3 | Lenti ORF clone of Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC217799L4 | Lenti ORF clone of Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review