EPHA10 (NM_173641) Human Untagged Clone

CAT#: SC306893

EPHA10 (untagged)-Human EPH receptor A10 (EPHA10), transcript variant 2


  "NM_173641" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EPHA10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPHA10
Synonyms FLJ16103; FLJ33655; MGC43817
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_173641, the custom clone sequence may differ by one or more nucleotides
ATGGAGACCTGCGCCGGTCCACACCCGCTGCGCCTCTTCCTCTGCCGGATGCAGCTCTGT
CTCGCGCTGCTTTTGGGACCCTGGCGGCCTGGGACCGCCGAGGAAGTTATCCTCCTGGAT
TCCAAAGCCTCCCAGGCCGAGCTGGGCTGGACTGCACTGCCAAGTAATGGGTGGGAGGAG
ATCAGCGGCGTGGATGAACACGACCGTCCCATCCGCACGTACCAAGTGTGCAATGTGCTG
GAGCCCAACCAGGACAACTGGCTGCAGACTGGCTGGATAAGCCGTGGCCGCGGGCAGCGC
ATCTTCGTGGAACTGCAGTTCACACTCCGTGACTGCAGCAGCATCCCTGGCGCCGCGGGT
ACCTGCAAGGAGACCTTCAACGTCTACTACCTGGAAACTGAGGCCGACCTGGGCCGTGGG
CGTCCCCGCCTAGGCGGCAGCCGGCCCCGCAAAATCGACACGATCGCGGCGGACGAGAGC
TTCACGCAGGGCGACCTGGGTGAGCGCAAGATGAAGCTGAACACAGAGGTGCGCGAGATC
GGACCGCTCAGCCGGCGGGGTTTCCACCTGGCCTTTCAGGACGTGGGCGCATGCGTGGCG
CTTGTCTCGGTGCGCGTCTACTACAAGCAGTGCCGCGCCACCGTGCGGGGCCTGGCCACG
TTCCCAGCCACCGCAGCCGAGAGCGCCTTCTCCACACTGGTGGAAGTGGCCGGAACGTGC
GTGGCGCACTCGGAAGGGGAGCCTGGCAGCCCCCCACGCATGCACTGCGGCGCCGACGGC
GAGTGGCTGGTGCCTGTGGGCCGCTGCAGCTGCAGCGCGGGATTCCAGGAGCGTGGTGAC
TTCTGCGAAGGTATCCAGTTGGCTGGGGGCCGTGGGGTGGGAGTGTAG
Restriction Sites Please inquire     
ACCN NM_173641
ORF Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_173641.1, NP_775912.1
RefSeq Size 2020
RefSeq ORF 888
Locus ID 284656
Protein Families Druggable Genome, Protein Kinase
Gene Summary Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins. [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) contains only the first three exons and some of the third intron compared to variant 3. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 3. Sequence Note: This sequence has been modified as follows: removed 16 bp suspected to be vector contamination from the 5' end.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.