SOX5 (NM_178010) Human Untagged Clone

CAT#: SC307123

SOX5 (untagged)-Human SRY (sex determining region Y)-box 5 (SOX5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SOX5
• Synonyms: L-SOX5; L-SOX5B; L-SOX5F; LAMSHF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_178010, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCATGATGAAGTGGCACAGCCACTGAACCTATCAGCTAAACCCAAGACCTCTGATGGCAAATCACCCA
  CATCACCCACCTCTCCCCATATGCCAGCTCTGAGAATAAACAGTGGGGCAGGCCCCCTCAAAGCCTCTGT
  CCCAGCAGCGTTAGCTAGTCCTTCAGCCAGAGTTAGCACAATAGGTTACTTAAATGACCATGATGCTGTC
  ACCAAGGCAATCCAAGAAGCTCGGCAAATGAAGGAGCAACTCCGACGGGAACAACAGGTGCTTGATGGGA
  AGGTGGCTGTTGTGAATAGTCTGGGTCTCAATAACTGCCGAACAGAAAAGGAAAAAACAACACTGGAGAG
  TCTGACTCAGCAACTGGCAGTTAAACAGAATGAAGAAGGAAAATTTAGCCATGCAATGATGGATTTCAAT
  CTGAGTGGAGATTCTGATGGAAGTGCTGGAGTCTCAGAGTCAAGAATTTATAGGGAATCCCGAGGGCGTG
  GTAGCAATGAACCCCACATAAAGCGTCCAATGAATGCCTTCATGGTGTGGGCTAAAGATGAACGGAGAAA
  GATCCTTCAAGCCTTTCCTGACATGCACAACTCCAACATCAGCAAGATATTGGGATCTCGCTGGAAAGCT
  ATGACAAACCTAGAGAAACAGCCATATTATGAGGAGCAAGCCCGTCTCAGCAAGCAGCACCTGGAGAAGT
  ACCCTGACTATAAGTACAAGCCCAGGCCAAAGCGCACCTGCCTGGTGGATGGCAAAAAGCTGCGCATTGG
  TGAATACAAGGCAATCATGCGCAACAGGCGGCAGGAAATGCGGCAGTACTTCAATGTTGGGCAACAAGCA
  CAGATCCCCATTGCCACTGCTGGTGTTGTGTACCCTGGAGCCATCGCCATGGCTGGGATGCCCTCCCCTC
  ACCTGCCCTCGGAGCACTCAAGCGTGTCTAGCAGCCCAGAGCCTGGGATGCCTGTTATCCAGAGCACTTA
  CGGTGTGAAAGGAGAGGAGCCACATATCAAAGAAGAGATACAGGCCGAGGACATCAATGGAGAAATTTAT
  GATGAGTACGACGAGGAAGAGGATGATCCAGATGTAGATTATGGGAGTGACAGTGAAAACCATATTGCAG
  GACAAGCCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_178010
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_178010.2, NP_821078.1
• RefSeq Size: 3133 bp
• RefSeq ORF: 1134 bp
• Locus ID: 6660
• Cytogenetics: 12p12.1
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) contains an alternate first exon in place of much of the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.