RNF138 (NM_198128) Human Untagged Clone

CAT#: SC307631

RNF138 (untagged)-Human ring finger protein 138 (RNF138), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNF138
• Synonyms: hNARF; HSD-4; NARF; STRIN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198128, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGAGGACCTCTCTGCGGCCACGTCCTACACCGAAGATGATTTCTACTGCCCCGTCTGTCAGGAGG
  TGCTCAAAACGCCCGTGCGGACCACGGCCTGTCAGCACGTCAATAGGAGTGAAACATCCACATCTGATAA
  CACAGAAACTTACCAAGAGAATACAAGTTCTTCTGGTCATCCTACTTTTAAGTGTCCCCTGTGTCAAGAA
  TCAAATTTTACCAGACAGCGTTTACTGGATCACTGTAACAGTAATCACCTATTTCAGATAGTTCCTGTGA
  CATGTCCTATTTGTGTGTCTCTTCCTTGGGGAGATCCTAGCCAGATTACCAGAAATTTCGTTAGTCATCT
  AAATCAGAGACATCAATTTGATTATGGAGAATTTGTGAATCTTCAGCTAGATGAAGAAACCCAATACCAA
  ACTGCTGTTGAAGAATCTTTTCAAGTAAACATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198128
• ORF Size: 456 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_198128.2, NP_937761.1
• RefSeq Size: 3016
• RefSeq ORF: 456
• Locus ID: 51444
• Gene Summary: The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1.