Osteocrin (OSTN) (NM_198184) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OSTN |
Synonyms | MUSCLIN |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_198184 edited
ATGCTGGACTGGAGATTGGCAAGTGCACATTTCATCCTGGCTGTGACACTGACACTGTGG AGCTCAGGAAAAGTCCTCTCAGTAGATGTAACAACAACAGAGGCCTTTGATTCTGGAGTC ATAGATGTGCAGTCAACACCCACAGTCAGGGAAGAGAAATCAGCCACTGACCTGACAGCA AAACTCTTGCTTCTTGATGAATTGGTGTCCCTAGAAAATGATGTGATTGAGACAAAGAAG AAAAGGAGTTTCTCTGGTTTTGGGTCTCCCCTTGACAGACTCTCAGCTGGCTCTGTAGAT CACAAAGGTAAACAGAGGAAAGTAGTAGATCATCCAAAAAGGCGATTTGGTATCCCCATG GATCGGATTGGTAGAAACCGGCTTTCAAATTCCAGAGGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_198184 |
ORF Size | 402 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Reference Data | |
RefSeq | NM_198184.1, NP_937827.1 |
RefSeq Size | 402 |
RefSeq ORF | 402 |
Locus ID | 344901 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219416 | OSTN (Myc-DDK-tagged)-Human osteocrin (OSTN) |
USD 420.00 |
|
RG219416 | OSTN (GFP-tagged) - Human osteocrin (OSTN) |
USD 460.00 |
|
RC219416L1 | Lenti ORF clone of Human osteocrin (OSTN), Myc-DDK-tagged |
USD 620.00 |
|
RC219416L2 | Lenti ORF clone of Human osteocrin (OSTN), mGFP tagged |
USD 620.00 |
|
RC219416L3 | Lenti ORF clone of Human osteocrin (OSTN), Myc-DDK-tagged |
USD 620.00 |
|
RC219416L4 | Lenti ORF clone of Human osteocrin (OSTN), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review