Osteocrin (OSTN) (NM_198184) Human Untagged Clone

CAT#: SC307642

OSTN (untagged)-Human osteocrin (OSTN)


  "NM_198184" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "OSTN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OSTN
Synonyms MUSCLIN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_198184 edited
ATGCTGGACTGGAGATTGGCAAGTGCACATTTCATCCTGGCTGTGACACTGACACTGTGG
AGCTCAGGAAAAGTCCTCTCAGTAGATGTAACAACAACAGAGGCCTTTGATTCTGGAGTC
ATAGATGTGCAGTCAACACCCACAGTCAGGGAAGAGAAATCAGCCACTGACCTGACAGCA
AAACTCTTGCTTCTTGATGAATTGGTGTCCCTAGAAAATGATGTGATTGAGACAAAGAAG
AAAAGGAGTTTCTCTGGTTTTGGGTCTCCCCTTGACAGACTCTCAGCTGGCTCTGTAGAT
CACAAAGGTAAACAGAGGAAAGTAGTAGATCATCCAAAAAGGCGATTTGGTATCCCCATG
GATCGGATTGGTAGAAACCGGCTTTCAAATTCCAGAGGCTAA
Restriction Sites Please inquire     
ACCN NM_198184
ORF Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Reference Data
RefSeq NM_198184.1, NP_937827.1
RefSeq Size 402
RefSeq ORF 402
Locus ID 344901
Protein Families ES Cell Differentiation/IPS, Secreted Protein

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.