CLEC12A (NM_201623) Human Untagged Clone

CAT#: SC308074

CLEC12A (untagged)-Human C-type lectin domain family 12, member A (CLEC12A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC12A
• Synonyms: CD371; CLL-1; CLL1; DCAL-2; MICL
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_201623 edited
  ATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGAACTCCAGTGAGATGGAAAAA
  ATCCCAGAAATTGGCAAATTTGGGGAAAAAGTTCACGTAACTTTGAAGATAGAAATGAAA
  AAAATGAACAAACTACAAAACATCAGTGAAGAGCTCCAGAGAAATATTTCTCTACAACTG
  ATGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTCCACCACACTGCAAACAATA
  GCCACCAAATTATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGTAAGCCTTGT
  CCAAGGAGATGGATTTGGCATAAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACA
  TGGCAGGAGAGTAAAATGGCCTGTGCTGCTCAGAATGCCAGCCTGTTGAAGATAAACAAC
  AAAAATGCATTGGAATTTATAAAATCCCAGAGTAGATCATATGACTATTGGCTGGGATTA
  TCTCCTGAAGAAGATTCCACTCGTGGTATGAGAGTGGATAATATAATCAACTCCTCTGCC
  TGGGTTATAAGAAACGCACCTGACTTAAATAACATGTATTGTGGATATATAAATAGACTA
  TATGTTCAATATTATCACTGCACTTATAAAAAAAGAATGATATGTGAGAAGATGGCCAAT
  CCAGTGCAGCTTGGTTCTACATATTTTAGGGAGGCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_201623
• ORF Size: 699 bp
• Insert Size: 1600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_201623.1, NP_963917.1
• RefSeq Size: 1474
• RefSeq ORF: 699
• Locus ID: 160364
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2, also referred to as beta), compared to isoform 1.