Repulsive Guidance Molecule C (HFE2) (NM_202004) Human Untagged Clone

CAT#: SC308091

HFE2 (untagged)-Human hemochromatosis type 2 (juvenile) (HFE2), transcript variant c

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HFE2
• Synonyms: HFE2; HFE2A; JH; RGMC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_202004, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGGAATGCATTGATCAGAAGGTGTATCAGGCTGAGGTGGATAATCTTCCTGTAGCCTTTGAAGATG
  GTTCTATCAATGGAGGTGACCGACCTGGGGGATCCAGTTTGTCGATTCAAACTGCTAACCCTGGGAACCA
  TGTGGAGATCCAAGCTGCCTACATTGGCACAACTATAATCATTCGGCAGACAGCTGGGCAGCTCTCCTTC
  TCCATCAAGGTAGCAGAGGATGTGGCCATGGCCTTCTCAGCTGAACAGGACCTGCAGCTCTGTGTTGGGG
  GGTGCCCTCCAAGTCAGCGACTCTCTCGATCAGAGCGCAATCGTCGGGGAGCTATAACCATTGATACTGC
  CAGACGGCTGTGCAAGGAAGGGCTTCCAGTGGAAGATGCTTACTTCCATTCCTGTGTCTTTGATGTTTTA
  ATTTCTGGTGATCCCAACTTTACCGTGGCAGCTCAGGCAGCACTGGAGGATGCCCGAGCCTTCCTGCCAG
  ACTTAGAGAAGCTGCATCTCTTCCCCTCAGATGCTGGGGTTCCTCTTTCCTCAGCAACCCTCTTAGCTCC
  ACTCCTTTCTGGGCTCTTTGTTCTGTGGCTTTGCATTCAGTAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_202004
• ORF Size: 603 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_202004.2, NP_973733.1
• RefSeq Size: 1438
• RefSeq ORF: 603
• Locus ID: 148738
• Protein Families: Transmembrane
• Gene Summary: The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Two uORFs in the 5' UTR negatively regulate the expression and activity of the encoded protein. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, Oct 2015]
  Transcript Variant: This variant (c) lacks two segments in the 5' UTR and an in-frame portion of the 5' coding region, compared to variant a. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. Variants c, d, and e all encode the same isoform (c).