FAM9B (NM_205849) Human Untagged Clone

CAT#: SC308238

FAM9B (untagged)-Human family with sequence similarity 9, member B (FAM9B)


  "NM_205849" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM9B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM9B
Synonyms TEX39B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_205849, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCTGGGGGAAGAAGCATGCAGGAAAGGATCCAGTCCGTGATGAATGTGAGGAAAGAAACCGTT
TTACAGAAACAAGGGAGGAAGATGTAACTGATGAGCATGGGGAAAGAGAACCTTTTGCTGAAACAGATGA
ACACACGGGGGCTAATACCAAGAAGCCAGAAGATACTGCAGAGGATCTTACTGCAAAAAGAAAAAGGATG
AAAATGGATAAAACTTGCAGCAAAACAAAGAACAAAAGTAAACATGCTTTGAGAAAAAAGCAACTTAAAA
GGCAGAAACGTGATTATATACATTCTCTGAAGTTGCTAAATGTCCTTGAAGAATACATCACAGACGAGCA
GAAAGAGGAAGAAGAAGAAGAGGGAGAAGAGGAAGAACTAATTAGAATATTTCAAGAACAACAGAAGAAG
TGGCAACAATATAGAAGTGTTAGGAGAGAGAGGCTGAAAGAGATGAAGCTGCTACGTGACCAATTCGTAA
AGGCTCTTGAGGACTTTGAAGACCTTTGTGACAGAGTTTTTTCCGATGAAGACAGTGAACTTGATAACTA
G


Restriction Sites SgfI-MluI     
ACCN NM_205849
ORF Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_205849.3, NP_995321.1
RefSeq Size 2103
RefSeq ORF 561
Locus ID 171483
Gene Summary This gene is a member of a gene family which arose through duplication on the X chromosome. The encoded protein may be localized to the nucleus as the protein contains several nuclear localization signals, and has similarity to a synaptonemal complex protein. [provided by RefSeq, Aug 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.