TRPM3 (NM_206948) Human Untagged Clone

CAT#: SC308341

TRPM3 (untagged)-Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRPM3
• Synonyms: GON-2; LTRPC3; MLSN2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_206948, the custom clone sequence may differ by one or more nucleotides
  ATGTATGTGCGAGTATCTTTTGATACAAAACCTGATCTCCTCTTACACCTGATGACCAAG
  GAATGGCAGTTGGAGCTTCCCAAGCTTCTCATCTCTGTCCATGGGGGCCTGCAGAACTTT
  GAACTCCAGCCAAAACTCAAGCAAGTCTTTGGGAAAGGGCTCATCAAAGCAGCAATGACA
  ACTGGAGCGTGGATATTCACTGGAGGGGTTAACACAGGTGTTATTCGTCATGTTGGCGAT
  GCCTTGAAGGATCATGCCTCTAAGTCTCGAGGAAAGATATGCACCATAGGTATTGCCCCC
  TGGGGAATTGTGGAAAACCAGGAGGACCTCATTGGAAGAGATGTTGTCCGGCCATACCAG
  ACCATGTCCAATCCCATGAGCAAGCTCACTGTTCTCAACAGCATGCATTCCCACTTCATT
  CTGGCTGACAACGGGACCACTGGAAAATATGGAGCAGAGGTGAAACTTCGAAGACAACTG
  GAAAAGCATATTTCACTCCAGAAGATAAACACAAGAATCGGTCAAGGTGTTCCTGTGGTG
  GCACTCATAGTGGAAGGAGGACCCAATGTGATCTCGATTGTTTTGGAGTACCTTCGAGAC
  ACCCCTCCCGTGCCAGTGGTTGTCTGTGATGGGAGTGGACGGGCATCGGACATCCTGGCC
  TTTGGGCATAAATACTCAGAAGAAGGCGGGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_206948
• ORF Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_206948.2, NP_996831.1
• RefSeq Size: 1303
• RefSeq ORF: 693
• Locus ID: 80036
• Protein Families: Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane
• Gene Summary: The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (7) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (h) has the same N-terminus but is shorter at the C-terminus compared to isoform a.