Endothelin 3 (EDN3) (NM_207032) Human Untagged Clone

CAT#: SC308367

EDN3 (untagged)-Human endothelin 3 (EDN3), transcript variant 2


  "NM_207032" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EDN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EDN3
Synonyms ET-3; ET3; HSCR4; PPET3; WS4B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_207032, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAGGATTCGTG
CCTTGCTCCCAGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCC
AGATCTGAGGGGGACTGTGAAGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGC
CCTGGCGAGGGGACTGTGGCCCCGACAGCACTGCAGGGTCCAAGCCCTGGAAGCCCTGGG
CAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCACCGATCCAGGCGCTGCACGTGCTTC
ACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATTTGGATCAACACT
CCCGAACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGG
TCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCT
TGTGTGGGGAGATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGC
AGTAATTCAAGGACGGCAGAAAAAACAGACAAAGAAGAGGAAGGGAAGGTGAGAGGTGCC
AACAGAGGCCTGTGTCAAAGGAGGTTGAAGTCAAGGACCAACAAAGCAAGCAGGCTTTAG
Restriction Sites Please inquire     
ACCN NM_207032
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_207032.1, NP_996915.1
RefSeq Size 2694 bp
RefSeq ORF 660 bp
Locus ID 1908
Cytogenetics 20q13.32
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]'
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 4. The encoded isoform (2), is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.