Endothelin 3 (EDN3) (NM_207033) Human Untagged Clone
CAT#: SC308368
EDN3 (untagged)-Human endothelin 3 (EDN3), transcript variant 3
"NM_207033" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDN3 |
Synonyms | ET-3; ET3; HSCR4; PPET3; WS4B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207033, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAGGATTCGTG CCTTGCTCCCAGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCC AGATCTGAGGGGGACTGTGAAGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGC CCTGGCGAGGGGACTGTGGCCCCGACAGCACTGCAGGGTCCAAGCCCTGGAAGCCCTGGG CAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCACCGATCCAGGCGCTGCACGTGCTTC ACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATTTGGATCAACACT CCCGAACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGG TCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCT TGTGTGGGGAGATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGC AGACAGGTTGAAGTCAAGGACCAACAAAGCAAGCAGGCTTTAGACCTCCACCATCCAAAG CTCATGCCCGGCAGTGGACTCGCCCTCGCTCCATCTACCTGCCCCCGCTGCCTCTTTCAG GAAGGAGCCCCTTAG |
Restriction Sites | Please inquire |
ACCN | NM_207033 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207033.1, NP_996916.1 |
RefSeq Size | 2617 bp |
RefSeq ORF | 675 bp |
Locus ID | 1908 |
Cytogenetics | 20q13.32 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]' Transcript Variant: This variant (3) lacks an exon in the 3' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 4. The encoded isoform (3) is shorter and has two distinct internal amino acids, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220103 | EDN3 (Myc-DDK-tagged)-Human endothelin 3 (EDN3), transcript variant 3 |
USD 420.00 |
|
RG220103 | EDN3 (GFP-tagged) - Human endothelin 3 (EDN3), transcript variant 3 |
USD 460.00 |
|
RC220103L3 | Lenti-ORF clone of EDN3 (Myc-DDK-tagged)-Human endothelin 3 (EDN3), transcript variant 3 |
USD 620.00 |
|
RC220103L4 | Lenti-ORF clone of EDN3 (mGFP-tagged)-Human endothelin 3 (EDN3), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review