MBNL1 (NM_207292) Human Untagged Clone

CAT#: SC308424

MBNL1 (untagged)-Human muscleblind-like (Drosophila) (MBNL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MBNL1
• Synonyms: EXP; MBNL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_207292, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGTTAGTGTCACACCAATTCGGGACACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTCCAGA
  GGGGGACTTGCTCACGGCCAGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAAAA
  TGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGCCGTTGCTCCAGGGAGAACTGCAAATATCTTCAT
  CCACCCCCACATTTAAAAACGCAGTTGGAGATAAATGGACGCAATAACTTGATTCAGCAGAAGAACATGG
  CCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCTGGTGCCCCATTACAACCCGTGCCAAT
  GTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCGCCTTTAATCCCTATCTGGGACCTGTT
  TCTCCAAGCCTGGTCCCGGCAGAGATCTTGCCGACTGCACCAATGTTGGTTACAGGGAATCCGGGTGTCC
  CTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGAACAGACAGACTTGAGGTATGTCGAGA
  GTACCAACGTGGCAATTGCAACCGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGACAGCACAATG
  ATTGACACCAATGACAACACAGTCACTGTGTGTATGGATTACATCAAAGGGAGATGCTCTCGGGAAAAGT
  GCAAATACTTTCATCCCCCTGCACATTTGCAAGCCAAGATCAAGGCTGCCCAATACCAGGTCAACCAGGC
  TGCAGCTGCACAGGCTGCAGCCACCGCAGCTGCCATGGGAATTCCTCAAGCTGTACTTCCCCCATTACCA
  AAGAGGCCTGCTCTTGAAAAAACCAACGGTGCCACCGCAGTCTTTAACACTGGTATTTTCCAATACCAAC
  AGGCTCTAGCCAACATGCAGTTACAACAGCATACAGCATTTCTCCCACCAGTTCCCATGGTGCACGGTGC
  TACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCC
  AACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_207292
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_207292.2, NP_997175.1
• RefSeq Size: 5961 bp
• RefSeq ORF: 1113 bp
• Locus ID: 4154
• Cytogenetics: 3q25.1-q25.2
• Gene Summary: 'This gene encodes a member of the muscleblind protein family which was initially described in Drosophila melanogaster. The encoded protein is a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Mice lacking this gene exhibited muscle abnormalities and cataracts. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. The different isoforms are thought to have different binding specificities and/or splicing activities. [provided by RefSeq, Sep 2015]'
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Other names for this isoform are EXP40 and MBNL1subscript40.