CLEC9A (NM_207345) Human Untagged Clone
CAT#: SC308466
CLEC9A (untagged)-Human C-type lectin domain family 9, member A (CLEC9A)
"NM_207345" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLEC9A |
Synonyms | CD370; DNGR-1; DNGR1; UNQ9341 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_207345 edited
GCACCTTAGACATGCACGAGGAAGAAATATACACCTCTCTTCAGTGGGATAGCCCAGCAC CAGACACTTACCAGAAATGTCTGTCTTCCAACAAATGTTCAGGAGCATGCTGTCTTGTGA TGGTGATTTCATGTGTTTTCTGCATGGGATTATTAACAGCATCCATTTTCTTGGGCGTCA AGTTGTTGCAGGTGTCCACCATTGCGATGCAGCAGCAAGAAAAACTCATCCAACAAGAGA GGGCACTGCTAAACTTTACAGAATGGAAGAGAAGCTGTGCCCTTCAGATGAAATATTGCC AAGCCTTCATGCAAAACTCATTAAGTTCAGCCCATAACAGCAGTCCTTGTCCAAACAATT GGATTCAGAACAGAGAAAGTTGTTACTATGTCTCTGAAATTTGGAGCATTTGGCACACCA GTCAAGAGAATTGTTTAAAGGAAGGTTCCACGCTGCTACAAATAGAGAGCAAAGAAGAAA TGGATTTTATCACTGGCAGCTTGAGGAAGATTAAAGGAAGCTATGATTACTGGGTGGGGT TGTCTCAGGATGGACACAGCGGACGCTGGCTTTGGCAAGATGGCTCCTCTCCTTCTCCTG GCCTGTTGCCAGCAGAGAGATCCCAGTCAGCTAACCAAGTCTGTGGATACGTGAAAAGCA ATTCCCTTCTTTCGTCTAACTGCAGCACGTGGAAGTATTTTATCTGTGAGAAGTATGCGT TGAGATCCTCTGTCTGAAAGAAATTG |
Restriction Sites | Please inquire |
ACCN | NM_207345 |
ORF Size | 726 bp |
Insert Size | 800 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_207345.1, NP_997228.1 |
RefSeq Size | 1674 |
RefSeq ORF | 726 |
Locus ID | 283420 |
Protein Families | Transmembrane |
Gene Summary | CLEC9A is a group V C-type lectin-like receptor (CTLR) that functions as an activation receptor and is expressed on myeloid lineage cells (Huysamen et al., 2008 [PubMed 18408006]). [supplied by OMIM, Aug 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217845 | CLEC9A (Myc-DDK-tagged)-Human C-type lectin domain family 9, member A (CLEC9A) |
USD 420.00 |
|
RG217845 | CLEC9A (GFP-tagged) - Human C-type lectin domain family 9, member A (CLEC9A) |
USD 460.00 |
|
RC217845L1 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), Myc-DDK-tagged |
USD 620.00 |
|
RC217845L2 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), mGFP tagged |
USD 620.00 |
|
RC217845L3 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), Myc-DDK-tagged |
USD 768.00 |
|
RC217845L4 | Lenti ORF clone of Human C-type lectin domain family 9, member A (CLEC9A), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review