CLCN6 (NM_021737) Human Untagged Clone

CAT#: SC309476

CLCN6 (untagged)-Human chloride channel 6 (CLCN6), transcript variant ClC-6d


  "NM_021737" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLCN6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLCN6
Synonyms CLC-6; KIAA0046
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021737, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGTGCAGGGGGTCTCTGTGCTGCTGCTGCAGGTGGTGCTGCTGCTGCGGTGAG
CGTGAGACCCGCACCCCCGAGGAGCTGACCATCCTTGGAGAAACACAGGAGGAGGAGGAT
GAGATTCTTCCAAGGAAAGACTATGAGAGTTTGGATTATGATCGCTGTATCAATGACCCT
TACCTGGAAGTTTTGGAGACCATGGATAATAAGAAAGGTCGAAGATATGAGGCGGTGAAG
TGGATGGTGGTGTTTGCCATTGGAGTCTGCACTGGCCTGGTGGGTCTCTTTGTGGACTTT
TTTGTGCGACTCTTCACCCAACTCAAGTTCGGAGTGGTACAGACATCGGTGGAGGAGTGC
AGCCAGAAAGGCTGCCTCGCTCTGTCTCTCCTTGAACTCCTGGGTTTTAACCTCACCTTT
GTCTTCCTGGCAAGCCTCCTTGTTCTCATTGAGCCGGTGGCAGCAGGTTCCGGGATACCC
GAGGTCAAATGCTATCTGAATGGCGTAAAGGTGCCAGGAATCGTCCGTCTCCGGACCCTG
CTCTGCAAGGTCCTTGGAGTGCTGTTCAGTGTGGCTGGAGGGCTCTTCGTGGGGAAGGAA
GGCCCCATGATCCACAGTGGTTCGGTGGTGGGAGCTGGCCTCCCTCAGTTTCAGAGCATC
TCCTTACGGAAGATCCAGTTTAACTTCCCCTATTTCCGAAGCGACAGGAGCGGCTGCTGG
AGTTGCTGCAGCTTTCGGGGCGCCAATCGGGGGTACCTTGTTCAGTCTAGAGGAGGGTTC
GTCCTTCTGGAACCAAGGGCTCACGTGGAAAGTGCTCTTTTGTTCCATGTCTGCCACCTT
CACCCTCAACTTCTTCCGTTCTGGGATTCAGTTTGGAAGCTGGGGTTCCTTCCAGCTCCC
TGGATTGCTGAACTTTGGCGAGTTTAA
Restriction Sites Please inquire     
ACCN NM_021737
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021737.1, NP_068505.1
RefSeq Size 3858 bp
RefSeq ORF 927 bp
Locus ID 1185
Cytogenetics 1p36.22
Domains voltage_CLC
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (ClC-6d) lacks an internal coding segment of 26 nts and multiple 3' coding exons, as compared to variant ClC-6a. The resulting isoform ClC-6d has a shorter and distinct C-terminus, as compared to ClC-6a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.