MURF2 (TRIM55) (NM_184087) Human Untagged Clone

CAT#: SC309694

TRIM55 (untagged)-Human tripartite motif containing 55 (TRIM55), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIM55
• Synonyms: MURF-2; muRF2; RNF29
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_184087, the custom clone sequence may differ by one or more nucleotides
  ATGAGCGCATCTCTGAATTACAAATCTTTTTCCAAAGAGCAGCAGACCATGGATAACTTA
  GAGAAGCAACTCATCTGTCCCATCTGCTTAGAGATGTTCACGAAACCTGTGGTGATTCTC
  CCTTGTCAGCACAACCTGTGTAGGAAATGTGCCAGTGATATTTTCCAGGCCTCTAACCCG
  TATTTGCCCACAAGAGGAGGTACCACCATGGCATCAGGGGGCCGATTCCGCTGCCCATCC
  TGTAGACATGAAGTGGTTTTGGATAGACATGGGGTATATGGACTTCAGAGGAACCTGCTG
  GTGGAAAATATCATTGACATCTACAAGCAGGAGTCCACCAGGCCAGAAAAGAAATCCGAC
  CAGCCCATGTGCGAGGAACATGAAGAGGAGCGCATCAACATCTACTGTCTGAACTGCGAA
  GTACCCACCTGCTCTCTGTGCAAGGTGTTTGGTGCACACAAAGACTGCCAGGTGGCTCCC
  CTCACTCATGTGTTCCAGAGACAGAAGTCTGAGCTCAGTGATGGCATCGCCATCCTCGTG
  GGCAGCAACGATCGAGTCCAGGGAGTGATCAGCCAGCTGGAAGACACCTGCAAAACTATC
  GAGATTGGATTTGAGGCTCCTCCCCTCCAGGGACAGGCTGCAGCTCCAGCGAGTGGCAGT
  GGAGCTGATTCTGAGCCAGCTCGCCATATCTTCTCCTTTTCCTGGTTGAACTCCCTAAAT
  GAATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_184087
• ORF Size: 726 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_184087.1, NP_908975.1
• RefSeq Size: 1850
• RefSeq ORF: 726
• Locus ID: 84675
• Gene Summary: The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks four exons within the coding region compared to variant 1. The translation frame remains the same. The resulting isoform (4) lacks an internal region, as compared to isoform 1. This isoform (4) was detected specifically in cardiac muscle.