DcR3 (TNFRSF6B) (NM_032945) Human Untagged Clone

CAT#: SC310554

TNFRSF6B (untagged)-Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant M68C

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFRSF6B
• Synonyms: DCR3; decoy receptor 3; DJ583P15.1.1; M68; OTTHUMP00000031583; TR6; tumor necrosis factor receptor superfamily, member 6b; tumor necrosis factor receptor superfamily, member 6b, decoy
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032945, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGGCGCTGGAGGGGCCAGGCCTGTCGCTGCTGTGCCTGGTGTTGGCGCTGCCTGCCCTGCTGCCGG
  TGCCGGCTGTACGCGGAGTGGCAGAAACACCCACCTACCCCTGGCGGGACGCAGAGACAGGGGAGCGGCT
  GGTGTGCGCCCAGTGCCCCCCAGGCACCTTTGTGCAGCGGCCGTGCCGCCGAGACAGCCCCACGACGTGT
  GGCCCGTGTCCACCGCGCCACTACACGCAGTTCTGGAACTACCTGGAGCGCTGCCGCTACTGCAACGTCC
  TCTGCGGGGAGCGTGAGGAGGAGGCACGGGCTTGCCACGCCACCCACAACCGTGCCTGCCGCTGCCGCAC
  CGGCTTCTTCGCGCACGCTGGTTTCTGCTTGGAGCACGCATCGTGTCCACCTGGTGCCGGCGTGATTGCC
  CCGGGCACCCCCAGCCAGAACACGCAGTGCCAGCCGTGCCCCCCAGGCACCTTCTCAGCCAGCAGCTCCA
  GCTCAGAGCAGTGCCAGCCCCACCGCAACTGCACGGCCCTGGGCCTGGCCCTCAATGTGCCAGGCTCTTC
  CTCCCATGACACCCTGTGCACCAGCTGCACTGGCTTCCCCCTCAGCACCAGGGTACCAGGAGCTGAGGAG
  TGTGAGCGTGCCGTCATCGACTTTGTGGCTTTCCAGGACATCTCCATCAAGAGGCTGCAGCGGCTGCTGC
  AGGCCCTCGAGGCCCCGGAGGGCTGGGGTCCGACACCAAGGGCGGGCCGCGCGGCCTTGCAGCTGAAGCT
  GCGTCGGCGGCTCACGGAGCTCCTGGGGGCGCAGGACGGGGCGCTGCTGGTGCGGCTGCTGCAGGCGCTG
  CGCGTGGCCAGGATGCCCGGGCTGGAGCGGAGCGTCCGTGAGCGCTTCCTCCCTGTGCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_032945
• ORF Size: 903 bp
• Insert Size: 903
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032945.2, NP_116563.1
• RefSeq Size: 1458
• RefSeq ORF: 903
• Locus ID: 8771
• Domains: TNFR
• Protein Families: Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (M68C) contains a longer 5' UTR compared to M68E. Both variants encode the same protein.