IL18BP (NM_001039660) Human Untagged Clone

CAT#: SC310756

IL18BP (untagged)-Human interleukin 18 binding protein (IL18BP), transcript variant F

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL18BP
• Synonyms: IL18BPa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039660, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGTGCCCACGTCG
  TCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCCACTGCCTCAGTTAGAAGCAC
  AAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCAGCTAAGCAGTGTCCAGCATTGGAAGTGACC
  TGGCCAGAGGTGGAAGTGCCACTGAATGGAACGCTGAGCTTATCCTGTGTGGCCTGCAGCCGCTTCCCCA
  ACTTCAGCATCCTCTACTGGCTGGGCAATGGTTCCTTCATTGAGCACCTCCCAGGCCGACTGTGGGAGGG
  GAGCACCAGCCGGGAACGTGGGAGCACAGGTACGCAGCTGTGCAAGGCCTTGGTGCTGGAGCAGCTGACC
  CCTGCCCTGCACAGCACCAACTTCTCCTGTGTGCTCGTGGACCCTGAACAGGTTGTCCAGCGTCACGTCG
  TCCTGGCCCAGCTCTGGGCTGGGCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCTGCCCTCCAGCCA
  CAGCAGTCCACAGCAGCAGGGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039660
• ORF Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039660.1, NP_001034749.1
• RefSeq Size: 1433
• RefSeq ORF: 585
• Locus ID: 10068
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (F) differs in the 5' UTR compared to variant A. Variants A, E, F and G encode the same isoform (a, also known as IL-18BPa).