IL18BP (NM_001039660) Human Untagged Clone
CAT#: SC310756
IL18BP (untagged)-Human interleukin 18 binding protein (IL18BP), transcript variant F
"NM_001039660" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL18BP |
Synonyms | IL18BPa |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001039660, the custom clone sequence may differ by one or more nucleotides
ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGTGCCCACGTCG TCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCCACTGCCTCAGTTAGAAGCAC AAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCAGCTAAGCAGTGTCCAGCATTGGAAGTGACC TGGCCAGAGGTGGAAGTGCCACTGAATGGAACGCTGAGCTTATCCTGTGTGGCCTGCAGCCGCTTCCCCA ACTTCAGCATCCTCTACTGGCTGGGCAATGGTTCCTTCATTGAGCACCTCCCAGGCCGACTGTGGGAGGG GAGCACCAGCCGGGAACGTGGGAGCACAGGTACGCAGCTGTGCAAGGCCTTGGTGCTGGAGCAGCTGACC CCTGCCCTGCACAGCACCAACTTCTCCTGTGTGCTCGTGGACCCTGAACAGGTTGTCCAGCGTCACGTCG TCCTGGCCCAGCTCTGGGCTGGGCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCTGCCCTCCAGCCA CAGCAGTCCACAGCAGCAGGGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039660 |
ORF Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001039660.1, NP_001034749.1 |
RefSeq Size | 1433 |
RefSeq ORF | 585 |
Locus ID | 10068 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (F) differs in the 5' UTR compared to variant A. Variants A, E, F and G encode the same isoform (a, also known as IL-18BPa). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222149 | IL18BP (Myc-DDK-tagged)-Human interleukin 18 binding protein (IL18BP), transcript variant F |
USD 420.00 |
|
RG222149 | IL18BP (GFP-tagged) - Human interleukin 18 binding protein (IL18BP), transcript variant F |
USD 460.00 |
|
RC222149L3 | Lenti ORF clone of Human interleukin 18 binding protein (IL18BP), transcript variant F, Myc-DDK-tagged |
USD 620.00 |
|
RC222149L4 | Lenti ORF clone of Human interleukin 18 binding protein (IL18BP), transcript variant F, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review