ELMO1 (NM_001039459) Human Untagged Clone

CAT#: SC310877

ELMO1 (untagged)-Human engulfment and cell motility 1 (ELMO1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELMO1
• Synonyms: CED-12; CED12; ELMO-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039459, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGGTGGTGAAGGAGCAGGTTATGAGAGCACTTACAACCAAGCCTAGCTCCCTGGACCAGTTCAAGA
  GCAAACTGCAGAACCTGAGCTACACTGAGATCCTGAAAATCCGCCAGTCCGAGAGGATGAACCAGGAAGA
  TTTCCAGTCCCGCCCGATTTTGGAACTAAAGGAGAAGATTCAGCCAGAAATCTTAGAGCTGATCAAACAG
  CAACGCCTGAACCGCCTTGTGGAAGGGACCTGCTTTAGGAAACTCAATGCCCGGCGGAGGCAAGACAAGT
  TTTGGTATTGTCGGCTTTCGCCAAATCACAAAGTCCTGCATTACGGAGACTTAGAAGAGAGTCCTCAGGG
  AGAAGTGCCCCACGATTCCTTGCAGGACAAACTGCCGGTGGCAGATATCAAAGCCGTGGTGACGGGAAAG
  GACTGCCCTCATATGAAAGAGAAAGGTGCCCTTAAACAAAACAAGGAGGTGCTTGAACTCGCTTTCTCCA
  TCTTGTATGACTCAAACTGCCAACTGAACTTCATCGCTCCTGACAAGCATGAGTACTGTATCTGGACGGA
  TGGACTGAATGCGCTACTCGGGAAGGACATGATGAGCGACCTGACGCGGAATGACCTGGACACCCTGCTC
  AGCATGGAAATCAAGCTCCGCCTCCTGGACCTGGAAAACATCCAGATCCCTGACGCACCTCCGCCGATTC
  CCAAGGAGCCCAGCAACTATGACTTCGTCTATGACTGTAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039459
• ORF Size: 744 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039459.2, NP_001034548.1
• RefSeq Size: 3590
• RefSeq ORF: 744
• Locus ID: 9844
• Protein Pathways: Chemokine signaling pathway
• Gene Summary: This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (3) represents use of an alternate promoter and differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.