Glutathione Peroxidase 4 (GPX4) (NM_001039848) Human Untagged Clone

CAT#: SC311015

GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 3 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Human Untagged Clone
• Symbol: GPX4
• Synonyms: GPx-4; GSHPx-4; MCSP; PHGPx; SMDS; snGPx; snPHGPx
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039848, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCCGCGCGGGCGCAGGCTCCCCCGGGCGCCGCAGGCAGCGGTGCCAGAGCCGGGGCAGGCGGCGGC
  CGCGAGCCCCTCGGCGGCGGAAGGCCCCAGCGTGCAGGCGCAGGAGGGCGCGGCGCCGGCGGAAGAAGCC
  CTGTCCCCGCAGCTTGCGACCGGAGATCCACGAATGTCCCAAGTCCCAGGACCCGTGCGCGTCCCGGGAC
  GACTGGCGCTGTGCGCGCTCCATGCACGAGTTTTCCGCCAAGGACATCGACGGGCACATGGTTAACCTGG
  ACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTA
  CACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAAC
  CAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAAT
  TCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCA
  ACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAAC
  GGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATT
  TCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001039848
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001039848.2, NP_001034937.1
• RefSeq Size: 1014 bp
• Locus ID: 2879
• Cytogenetics: 19p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Arachidonic acid metabolism, Glutathione metabolism
• Gene Summary: 'The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]'
  Transcript Variant: This variant (3) contains an alternate 5' terminal exon compared to variant 1. The resulting isoform (C) has a longer and a distinct N-terminus compared to isoform A. A similar isoform in rat (snGPx) has been reported to be localized in the sperm nucleus (PMID:11344099).