Gemin 8 (GEMIN8) (NM_001042480) Human Untagged Clone

CAT#: SC311242

GEMIN8 (untagged)-Human gem (nuclear organelle) associated protein 8 (GEMIN8), transcript variant 1


  "NM_001042480" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GEMIN8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GEMIN8
Synonyms FAM51A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001042480, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCGGTAAAGGCATCAACATCGAAAGCTACCAGGCCTTGGTATTCTCATCCGGTATATGCAAGAT
ACTGGCAACATTATCATCAAGCAATGGCTTGGATGCAAAGCCATCACAATGCCTACAGGAAGGCCGTGGA
ATCCTGTTTCAATCTTCCATGGTACTTACCTTCTGCGCTTCTTCCCCAAAGCTCTTACGATAATGAGGCT
GCGTATCCTCAGTCCTTCTATGACCATCATGTGGCCTGGCAGGACTACCCCTGCAGTTCTTCACATTTCA
GAAGATCTGGGCAGCATCCACGTTACAGCAGTAGGATCCAGGCATCCACAAAAGAAGACCAAGCTTTGTC
CAAAGAGGAAGAGATGGAGACTGAGTCAGATGCAGAGGTAGAATGTGACCTGAGCAATATGGAAATCACT
GAAGAGCTCCGCCAGTACTTTGCAGAGACCGAGAGGCATAGAGAAGAACGACGGCGGCAGCAGCAGCTGG
ATGCAGAGCGCCTGGACAGCTATGTGAACGCTGACCACGACCTGTACTGCAACACCCGCCGGTCGGTAGA
AGCCCCAACTGAGAGGCCTGGTGAGCGGCGCCAGGCCGAGATGAAGCGTTTGTACGGGGACAGTGCTGCC
AAGATCCAAGCCATGGAGGCCGCGGTGCAGCTGAGCTTTGACAAGCACTGTGACCGAAAGCAGCCCAAGT
ACTGGCCGGTCATCCCCCTGAAGTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001042480
ORF Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001042480.1, NP_001035945.1
RefSeq Size 3089
RefSeq ORF 729
Locus ID 54960
Gene Summary The protein encoded by this gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The encoded protein binds to both SMN1 and the GEMIN6/GEMIN7 heterodimer, mediating their interaction. This protein is found in nuclear Gemini of Cajal bodies (gems) and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. All three variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.