TPK1 (NM_001042482) Human Untagged Clone

CAT#: SC311347

TPK1 (untagged)-Human thiamin pyrophosphokinase 1 (TPK1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TPK1
• Synonyms: HTPK1; PP20; THMD5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001042482, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCATGCCTTTACCCCGTTGGAGCCCCTGCTTTCCACTGGGAATTTGAAGTACTGCCTTGTAATTC
  TTAATCAGCCTTTGGACAACTATTTTCGTCATCTTTGGAACAAAGCTCTTTTAAGAGCCTGTGCCGATGG
  AGGTGCCAACCGCTTATATGATATCACCGAAGGAGAGAGAGAAAGCTTTTTGCCTGAATTCATCAATGGA
  GACTTTGATTCTATTAGGCCTGAAGTCAGAGAATACTATGCTACTAAGGGATGTGAGCTCATTTCAACTC
  CTGATCAAGACCACACTGACTTTACTAAGTGCCTTAAAATGCTCCAAAAGAAGATAGAAGAAAAAGACTT
  AAAGGGAAAGCACAGGTTGCATGTAGACACTGGAATGGAGGGTGATTGGTGTGGCCTTATTCCTGTTGGA
  CAGCCTTGTATGCAGGTTACAACCACAGGCCTCAAGTGGAACCTCACAAATGATGTGCTTGCTTTTGGAA
  CATTGGTCAGTACTTCCAATACCTACGACGGGTCTGGTGTTGTGACTGTGGAAACTGACCACCCACTCCT
  CTGGACCATGGCCATCAAAAGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042482
• ORF Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001042482.1, NP_001035947.1
• RefSeq Size: 2302
• RefSeq ORF: 585
• Locus ID: 27010
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Thiamine metabolism
• Gene Summary: The protein encoded by this gene functions as a homodimer and catalyzes the conversion of thiamine to thiamine pyrophosphate, a cofactor for some enzymes of the glycolytic and energy production pathways. Defects in this gene are a cause of thiamine metabolism dysfunction syndrome-5. [provided by RefSeq, Apr 2017]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 4 both encode the same isoform (b).