UBE2V1 (NM_022442) Human Untagged Clone

CAT#: SC311658

UBE2V1 (untagged)-Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 3


  "NM_022442" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2V1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE2V1
Synonyms CIR1; CROC-1; CROC1; UBE2V; UEV-1; UEV1; UEV1A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_022442, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAAGACTTGAACCTAGAAAATTTCACTGCAAAGACAATTTATGAAAACCGAATA
TACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAAGCACCCCCCTTTGTAAGATTT
GTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAATGGAGTGGTGGACCCAAGAGCC
ATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATCAAAGTTGTCCTGCAAGAGCTT
CGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCTCAGCCGCCCGAAGGACAGTGT
TACAGCAAT
Restriction Sites Please inquire     
ACCN NM_022442
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022442.3, NP_071887.1
RefSeq Size 2194 bp
RefSeq ORF 2184 bp
Locus ID 7335
Cytogenetics 20q13.13
Domains UBCc
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (3) differs in the 5' UTR, initiates translation at an alternate start codon and lacks an exon in the coding region, compared to variant 1. Variants 3 and 6 encode the same isoform (c), which is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.