MTMR1 (AK055513) Human Untagged Clone

CAT#: SC311992

(untagged)-Human cDNA FLJ30951 fis, clone HCASM1000115

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "MTMR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MTMR1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK055513, the custom clone sequence may differ by one or more nucleotides
ATGTCCTTTTTTACGTTTAGAATAGTCACCCGAGGGGGGATCAGCTCAACTGTACTGTGG
GAGAAATTCTTTTCCAACAAACCTCATGCTCGTTTTTCTGTGGTGCAATTTCAAGGGCAA
CGTGTTCTGTCCTCACCTCACTCTGGTACTCGCCTCTTGGGGCGGCTCAGCCCATTCATG
GGGATGGCACCAAGCGGCCATGCTCAGTCCTCCAGCCCCGCTGAGGGTAAACCGAGGCCT
CTGGCAGCTGTGCACAGGTGCTGGCCTCTGGCTCCTTCAAGGAGCACTGCCTGTCACTCG
CTCCTGGGCTGTCTAGCCATGTCTCCCACCCCCACTTTACCGCAGCCAGCTGCTGGGATC
AAAGCAAGTCTGTTCTTATGTTATTTGCCTGTA
Restriction Sites Please inquire     
ACCN AK055513
ORF Size 2128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK055513.1
RefSeq Size 2128
RefSeq ORF 2128
Locus ID 8776
Protein Families Druggable Genome, Phosphatase
Protein Pathways Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
Gene Summary This gene encodes a member of the myotubularin related family of proteins. Members of this family contain the consensus sequence for the active site of protein tyrosine phosphatases. Alternatively spliced variants have been described but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.