GOLPH2 (GOLM1) (AK074188) Human Untagged Clone

CAT#: SC312110

(untagged)-Human cDNA FLJ23608 fis, clone ADKA01790

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "GOLM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GOLM1
Synonyms C9orf155|GOLPH2|GP73|HEL46|PSEC0257|bA379P1.3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK074188, the custom clone sequence may differ by one or more nucleotides
ATGGAGGGCCCTGAGCGAGACCAGCTTGTCATCCCCGACGGACAGGAGGAGGAGCAGGAA
GCTGCCGGGGAAGGTGGGTGTGAAGTTTCGGGGGCCGCTGTGGACTCCCTCCCACCAGAC
ACCCAGCCCACCTCCATGTCCTTCCCAGCACCAACATATCACCCTGAATTTTACCAAACA
GCAGTCCACAATTTGCCAATTCCTTTTCGTTTGAAGGTTTCTTATTCGTTATCAAGAGGG
AGGCAGGAAGGAAGAGCAGCATATGCTCTAGAACTCGAGGTTTTAGATGCAATATTGGCA
GGGAGTCGAGGGGACCTTGCAAGTGGGTGGCCTGCAGATGGGTGCTTAGCATCAAGTGGA
CGCCCCCTCCTGGCAGGCAGGCCACATGCCCCATTTTTGTATGTCCACCGTCGTGCAGTG
TCTGGTGCCATT
Restriction Sites Please inquire     
ACCN AK074188
ORF Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK074188.1, BAB85012.1
RefSeq Size 1618
RefSeq ORF 435
Locus ID 51280
Protein Families Transmembrane
Gene Summary The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.