ZDHHC22 (AK095612) Human Untagged Clone

CAT#: SC312227

(untagged)-Human cDNA FLJ38293 fis, clone FCBBF3009526


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZDHHC22"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZDHHC22
Synonyms C14orf59
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK095612, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCCCTGCGGCTGCTCAACGTGGTGGCCCCCGCCTACTTCTTGTGCATCTCCCTG
GTGACCTTCGTGCTGCAGCTCTTCCTCTTCCTGCCCAGCATGCGCGAGGACCCCGCGGCC
GCCCGGCTCTTCTCGCCCGCCCTGCTCCACGGGGCGCTCTTCCTATTCCTCTCGGCCAAC
GCCCTGGGCAATTACGTCCTTGTCATCCAGAACTCCCCAGACGACCTGGGGGCCTGCCAG
GGGGCCTCGGCCAGGAAGACTCCATGCCCCTCACCTAGCACCCACTTCTGCCGAGTGTGC
GCCAGAGTCACCCTGAGGCACGACCATCACTGTTTCTTCACCGGCAACTGCATCGGCAGC
AGGAACATGCGCAACTTCGTCCTGTTCTGCCTCTACACCTCCCTGGCGCAAGAACTTACA
AGAGGTCTTCGGAAAGAGGTGGCTGCTGGGCCTGCTGGTCCCCATGTTCAATGTCGGAAG
Restriction Sites Please inquire     
ACCN AK095612
ORF Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK095612.1, BAC04590.1
RefSeq Size 3097
RefSeq ORF 483
Locus ID 283576
Domains zf-DHHC

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.