INSIG1 (NM_198337) Human Untagged Clone

CAT#: SC312255

INSIG1 (untagged)-Human insulin induced gene 1 (INSIG1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: INSIG1
• Synonyms: CL6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_198337, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAGATTGCACGACCACTTCTGGAGCTGCTCCTGTGCGCACAGCGCGAGGCGCCGAGGCCCCCCGC
  GAGCCAGCGCCGCGGGGCTGGCGGCCAAGGTTGGGGAGATGATCAACGTTTCCGTGTCCGGGCCCTCCCT
  GCTGGCGGCCCACGGTGCCCCGGACGCTGACCCCGCGCCCAGGGGCCGCAGTGCTGCGATGAGCGGCCCC
  GAGCCCGGCAGCCCCTACCCCAACACCTGGCATCATCGCCTGTTGCAGAGGAGCCTCGTGCTCTTCTCGG
  TTGGGGTGGTCCTAGCCCTGGTGCTCAACCTGCTGCAGATCCAGAGGAATGTCACTCTCTTCCCCGAGGA
  GGTGATCGCCACCATCTTTTCCTCCGCCTGGTGGGTCCCTCCCTGCTGCGGGACAGCAGCTGGTATACAT
  CCCCAGATTTCCTCTATATTCGTTCTTGGCTCCCTTGTATATTTTTCTCAGGAGGCGTCACGGTGGGGAA
  CATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_198337
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_198337.2, NP_938151.1
• RefSeq Size: 2728 bp
• RefSeq ORF: 495 bp
• Locus ID: 3638
• Cytogenetics: 7q36.3
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'This gene encodes an endoplasmic reticulum membrane protein that regulates cholesterol metabolism, lipogenesis, and glucose homeostasis. The encoded protein has six transmembrane helices which contain an effector protein binding site. It binds the sterol-sensing domains of sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase), and is essential for the sterol-mediated trafficking of these two proteins. It promotes the endoplasmic reticulum retention of SCAP and the ubiquitin-mediated degradation of HMG-CoA reductase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]'
  Transcript Variant: This variant (3) lacks two exons in the coding region which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. Variants 3 and 7 encode the same protein.