OAS2 (BC010625) Human Untagged Clone

CAT#: SC312302

OAS2 (untagged)-Homo sapiens, clone IMAGE:3854948


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OAS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OAS2
Synonyms (2'-5')oligo(A) synthetase 2; 2'-5'-oligoadenylate synthetase 2; 2'-5'-oligoadenylate synthetase 2 (69-71 kD); 2'-5'-oligoadenylate synthetase 2, 69/71kDa; 2'5' oligoadenylate synthetase 2; 2-5A synthetase 2; MGC78578
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC010625, the custom clone sequence may differ by one or more nucleotides
ATGGGAAATGGGGAGTCCCAGCTGTCCTCGGTGCCTGCTCAGAAGCTGGGTTGGTTTATC
CAGGAATACCTGAAGCCCTACGAAGAATGTCAGACACTGATCGACGAGATGGTGAACACC
ATCTGTGACGTCCTGCAGGAACCCGAACAGTTCCCCCTGGTGCAGGGAGTGGCCATAGGT
GGCTCCTATGGACGGAAAACAGTCTTAAGAGGCAACTCCGATGGTACCCTTGTCCTCTTC
TTCAGTGACTTAAAACAATTCCAGGATCAGAAGAGAAGCCAACGTGACATCCTCGATAAA
ACTGGGGATAAGCTGAAGTTCTGTCTGTTCACGAAGTGGTTGAAAAACAATTTCGAGATC
CAGAAGTCCCTTGATGGGTTCACCATCCAGGTGTTCACAAAAAATCAGAGAATCTCTTTC
GAGGTGCTGGCCGCCTTCAACGCTCTGAGTAAGCATTGCTGGGTGTCAGGAGAGAAAAGC
CAAAGAAGGGGGTGCCAGACAGCTCTGTGCAACCTC
Restriction Sites Please inquire     
ACCN BC010625
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC010625.1, AAH10625.1
RefSeq Size 2087 bp
RefSeq ORF 519 bp
Locus ID 4939
Cytogenetics 12q24.13
Protein Families Druggable Genome
Gene Summary 'This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.