KLC1 (AK092888) Human Untagged Clone
CAT#: SC312497
(untagged)-Human cDNA FLJ35569 fis, clone SPLEN2005783
Product Images
Other products for "KLC1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK092888, the custom clone sequence may differ by one or more nucleotides
ATGTGGGAGCCCCTTGGGCTGTCTCATCATTTAGCAGTTGTCTTTACAGTGGTCCCATCC TCTGTAAAGACACACAGAGCCACATCACACATCCTCTATCCTAGGTGGAGCCCGGGGTCT GCCTCCCAGCTGCACCACCTTTGTCTGTCTGCAGGTCGCCAGCTCTGCTGGGGCCTTCTG AAGCAGCCTCTCTCCGTCTTGCCATTCTTTTCACACTGCTCCCATGTTAAGATTTCTACA CGTTTCGAAGACACTAAATTCTTACCTAGGATTATTGGGGAATGGAATATATGGTTAGAA ATAGATGAATTTTTATTTTTAAAAAATGACAATAAGGGCTGGACGAGGTGGCTCATGCCT GTAATCCCAGGACTTTGGGAGGCCGAGGCGGGTGGATCACTTGAGGCCAGGAGTTCGAGA CCAGCCTGGCCAACATGGCGAAAACTCGTCTGTGCGAAAAAAACAAAAATCAGCCAGGCA TGGTCGTGCGCGCCTGTAATCCCAGTTACTCAGGAGGCTGAGGCGGGGAATTGCTTGAAC CCAGTAGGTGGAGGCTGCATTGAGCCAAGATCATGCCACTGCACTCCAGCCTGGGTGACA GAGCCAGAATCTGTCTCAAATTACACTAGTAAGACAACTAGAATATGCCAAAAA |
Restriction Sites | Please inquire |
ACCN | AK092888 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK092888.1 |
RefSeq Size | 2841 bp |
RefSeq ORF | 2841 bp |
Locus ID | 3831 |
Cytogenetics | 14q32.33 |
Protein Families | Druggable Genome |
Gene Summary | 'Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature and/or biological validity of most of these variants have not been determined. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.