SLC27A4 (BC009959) Human Untagged Clone

CAT#: SC312587

SLC27A4 (untagged)-Homo sapiens, clone MGC:16752 IMAGE:4131025, complete cds


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC27A4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC27A4
Synonyms ACSVL4; FATP4; fatty acid transport protein 4; OTTHUMP00000022264; solute carrier family 27 (fatty acid transporter), member 4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC009959, the custom clone sequence may differ by one or more nucleotides
ATGCCCCTCACGCTGTCTACGCTGCTGCAACCGGGCCGCATCTGGACGGGGCGCCGCGCG
GCGGAGCCGACGCCGGGCCACAATGCTGCTTGGAGCCTCTCTGGTGGGGGTGCTGCTGTT
CTCCAAGCTGGTGCTGAAACTGCCCTGGACCCAGGTGGGATTCTCCCTGTTGTTCCTCTA
CTTGGGATCTGGCGGCTGGCGCTTCATCCGGGTCTTCATCAAGACCATCAGGCCTACCTT
ACTGGTGATGTGCTGGTGATGGACGAGCTGGGCTACCTGTACTTCCGAGACCGCACTGGG
GACACGTTCCGCTGGAAAGGTGAGAACGTGTCCACCACCGAGGTGGAAGGCACACTCAGC
CGCCTGCTGGACATGGCTGACGTGGCCGTGTATGGTGTCGAGGTGCCAGGAACCGAGGGC
CGGGCCGGAATGGCTGCTGTGGCCAGCCCCACTGGCAACTGTGACCTGGAGCGCTTTGCT
CAGGTCTTGGAGAAGGAACTGCCCCTGTATGCGCGCCCCATCTTCCTGCGCCTCCTGCCT
GAGCTGCACAAAACAGGAACCTACAAGTTCCAGAAGACAGAGCTACGGAAGGAGGGCTTT
GACCCGGCTATTGTGAAAGACCCGCTGTTCTATCTAGATGCCCAGAAGGGCCGCTACGTC
CCGCTGGACCAAGAGGCCTACAGCCGCATCCAGGCAGGCGAGGAGAAGCTG
Restriction Sites Please inquire     
ACCN BC009959
ORF Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq BC009959.1, AAH09959.1
RefSeq Size 1583
RefSeq ORF 714
Locus ID 10999
Protein Families Transmembrane
Protein Pathways PPAR signaling pathway
Gene Summary This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.