SLC27A4 (BC009959) Human Untagged Clone
CAT#: SC312587
SLC27A4 (untagged)-Homo sapiens, clone MGC:16752 IMAGE:4131025, complete cds
Product Images
Other products for "SLC27A4"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC27A4 |
Synonyms | ACSVL4; FATP4; fatty acid transport protein 4; OTTHUMP00000022264; solute carrier family 27 (fatty acid transporter), member 4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for BC009959, the custom clone sequence may differ by one or more nucleotides
ATGCCCCTCACGCTGTCTACGCTGCTGCAACCGGGCCGCATCTGGACGGGGCGCCGCGCG GCGGAGCCGACGCCGGGCCACAATGCTGCTTGGAGCCTCTCTGGTGGGGGTGCTGCTGTT CTCCAAGCTGGTGCTGAAACTGCCCTGGACCCAGGTGGGATTCTCCCTGTTGTTCCTCTA CTTGGGATCTGGCGGCTGGCGCTTCATCCGGGTCTTCATCAAGACCATCAGGCCTACCTT ACTGGTGATGTGCTGGTGATGGACGAGCTGGGCTACCTGTACTTCCGAGACCGCACTGGG GACACGTTCCGCTGGAAAGGTGAGAACGTGTCCACCACCGAGGTGGAAGGCACACTCAGC CGCCTGCTGGACATGGCTGACGTGGCCGTGTATGGTGTCGAGGTGCCAGGAACCGAGGGC CGGGCCGGAATGGCTGCTGTGGCCAGCCCCACTGGCAACTGTGACCTGGAGCGCTTTGCT CAGGTCTTGGAGAAGGAACTGCCCCTGTATGCGCGCCCCATCTTCCTGCGCCTCCTGCCT GAGCTGCACAAAACAGGAACCTACAAGTTCCAGAAGACAGAGCTACGGAAGGAGGGCTTT GACCCGGCTATTGTGAAAGACCCGCTGTTCTATCTAGATGCCCAGAAGGGCCGCTACGTC CCGCTGGACCAAGAGGCCTACAGCCGCATCCAGGCAGGCGAGGAGAAGCTG |
Restriction Sites | Please inquire |
ACCN | BC009959 |
ORF Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | BC009959.1, AAH09959.1 |
RefSeq Size | 1583 |
RefSeq ORF | 714 |
Locus ID | 10999 |
Protein Families | Transmembrane |
Protein Pathways | PPAR signaling pathway |
Gene Summary | This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.