FBXO22 (NM_012170) Human Untagged Clone

CAT#: SC312773

FBXO22 (untagged)-Human F-box protein 22 (FBXO22), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO22
• Synonyms: FBX22; FISTC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_012170, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCGGTAGGCTGCTGCGGCGAGTGCCGCGGCTCCTCCGTAGACCCGCGGAGCACCTTCGTGTTGA
  GTAACCTGGCGGAGGTGGTGGAGCGTGTGCTCACCTTCCTGCCCGCCAAGGCGTTGCTGCGGGTGGCCTG
  CGTGTGCCGCTTATGGAGGGAGTGTGTGCGCAGAGTATTGCGGACCCATCGGAGCGTAACCTGGATCTCC
  GCAGGCCTGGCGGAGGCCGGCCACCTGGAGGGGCATTGCTTGGTTCGCGTGGTAGCAGAGGAGCTTGAGA
  ATGTTCGCATCTTACCACATACAGTTCTTTACATGGCTGATTCAGAAACTTTCATTAGTCTGGAAGAGTG
  TCGTGGCCATAAGAGAGCAAGGAAAAGAACTAGTATGGAAACAGCACTTGCCCTTGAGAAGCTATTCCCC
  AAACAATGCCAAGTCCTTGGGATTGTGACCCCAGGAATTGTAGTGACTCCAATGGGATCAGGTAGCAATC
  GACCTCAGGAAATAGAAATTGGAGAATCTGGTTTTGCTTTATTATTCCCTCAAATTGAAGGAATAAAAAT
  ACAACCCTTTCATTTTATTAAGGATCCAAAGAATTTAACATTAGAAAGACATCAACTCACTGAAGTAGGT
  CTTTTAGATAACCCTGAACTTCGTGTGGTCCTTGTCTTTGGTTATAATTGCTGTAAGGTGGGAGCCAGTA
  ATTATCTGCAGCAAGTAGTCAGCACTTTCAGTGATATGAATATCATCTTGGCTGGAGGCCAGGTGGACAA
  CCTGTCATCACTGACTTCTGAAAAGTATGTCTTGTGTGCTTCTGATTTCGTCTGTGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_012170
• ORF Size: 831 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_012170.3, NP_036302.1
• RefSeq Size: 1717
• RefSeq ORF: 831
• Locus ID: 26263
• Domains: F-box
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and, as a transcriptional target of the tumor protein p53, is thought to be involved in degradation of specific proteins in response to p53 induction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (2) contains a distinct 3' coding sequence and 3' UTR compared to variant 1. This results in a shorter isoform (b) with a distinct C-terminus compared to isoform a.