KCTD7 (NM_153033) Human Untagged Clone

CAT#: SC312818

KCTD7 (untagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1


  "NM_153033" in other vectors (6)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KCTD7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCTD7
Synonyms CLN14; EPM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153033, the custom clone sequence may differ by one or more nucleotides


ATGGTGGTAGTCACGGGGCGGGAGCCAGACAGCCGTCGTCAGGACGGTGCCATGTCCAGCTCTGACGCCG
AAGACGACTTTCTGGAGCCGGCCACGCCGACGGCCACGCAGGCGGGGCACGCGCTGCCCCTGCTGCCACA
GGAGTTTCCTGAGGTTGTTCCCCTTAACATCGGAGGGGCTCACTTCACTACACGCCTGTCCACACTGCGG
TGCTACGAAGACACCATGTTGGCAGCCATGTTCAGTGGGCGGCACTACATCCCCACGGACTCCGAGGGCC
GGTACTTCATCGACCGAGATGGCACACACTTTGGAGATGTGCTGAATTTCCTGCGCTCAGGGGACCTCCC
ACCCAGGGAGCGTGTTCGAGCTGTGTACAAAGAGGCCCAGTACTATGCCATCGGGCCCCTCCTGGAGCAG
CTGGAGAACATGCAGCCACTGAAGGGCGAGAAGGTGCGCCAAGCGTTTCTGGGACTCATGCCCTATTACA
AAGACCACTTGGAGCGGATTGTGGAGATCGCCCGGCTGCGTGCGGTCCAGCGGAAGGCCCGCTTTGCCAA
GCTCAAGGTCTGTGTCTTCAAGGAGGAGATGCCCATCACCCCCTATGAGTGTCCGCTCCTCAACTCCCTG
CGATTTGAGCGGAGTGAGAGTGACGGGCAGCTTTTTGAGCACCACTGTGAAGTGGATGTGTCTTTTGGGC
CCTGGGAGGCTGTGGCTGATGTTTATGACCTGCTGCACTGCCTGGTCACGGACCTCTCGGCCCAGGGTCT
CACCGTGGACCACCAGTGCATCGGGGTGTGTGACAAGCACCTCGTGAACCACTACTACTGCAAGCGCCCC
ATCTATGAGTTCAAGATCACATGGTGGTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_153033
ORF Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153033.4, NP_694578.1
RefSeq Size 5051
RefSeq ORF 870
Locus ID 154881
Domains BTB, K_tetra
Protein Families Ion Channels: Other
Gene Summary This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.