KCTD7 (NM_153033) Human Untagged Clone
CAT#: SC312818
KCTD7 (untagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1
"NM_153033" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCTD7 |
Synonyms | CLN14; EPM3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_153033, the custom clone sequence may differ by one or more nucleotides
ATGGTGGTAGTCACGGGGCGGGAGCCAGACAGCCGTCGTCAGGACGGTGCCATGTCCAGCTCTGACGCCG AAGACGACTTTCTGGAGCCGGCCACGCCGACGGCCACGCAGGCGGGGCACGCGCTGCCCCTGCTGCCACA GGAGTTTCCTGAGGTTGTTCCCCTTAACATCGGAGGGGCTCACTTCACTACACGCCTGTCCACACTGCGG TGCTACGAAGACACCATGTTGGCAGCCATGTTCAGTGGGCGGCACTACATCCCCACGGACTCCGAGGGCC GGTACTTCATCGACCGAGATGGCACACACTTTGGAGATGTGCTGAATTTCCTGCGCTCAGGGGACCTCCC ACCCAGGGAGCGTGTTCGAGCTGTGTACAAAGAGGCCCAGTACTATGCCATCGGGCCCCTCCTGGAGCAG CTGGAGAACATGCAGCCACTGAAGGGCGAGAAGGTGCGCCAAGCGTTTCTGGGACTCATGCCCTATTACA AAGACCACTTGGAGCGGATTGTGGAGATCGCCCGGCTGCGTGCGGTCCAGCGGAAGGCCCGCTTTGCCAA GCTCAAGGTCTGTGTCTTCAAGGAGGAGATGCCCATCACCCCCTATGAGTGTCCGCTCCTCAACTCCCTG CGATTTGAGCGGAGTGAGAGTGACGGGCAGCTTTTTGAGCACCACTGTGAAGTGGATGTGTCTTTTGGGC CCTGGGAGGCTGTGGCTGATGTTTATGACCTGCTGCACTGCCTGGTCACGGACCTCTCGGCCCAGGGTCT CACCGTGGACCACCAGTGCATCGGGGTGTGTGACAAGCACCTCGTGAACCACTACTACTGCAAGCGCCCC ATCTATGAGTTCAAGATCACATGGTGGTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_153033 |
ORF Size | 870 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_153033.4, NP_694578.1 |
RefSeq Size | 5051 |
RefSeq ORF | 870 |
Locus ID | 154881 |
Domains | BTB, K_tetra |
Protein Families | Ion Channels: Other |
Gene Summary | This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221998 | KCTD7 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1 |
USD 420.00 |
|
RG221998 | KCTD7 (GFP-tagged) - Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1 |
USD 460.00 |
|
RC221998L1 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC221998L2 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC221998L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC221998L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 7 (KCTD7), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review