TRIM5 alpha (TRIM5) (NM_033093) Human Untagged Clone

CAT#: SC312969

TRIM5 (untagged)-Human tripartite motif containing 5 (TRIM5), transcript variant delta

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIM5
• Synonyms: RNF88; TRIM5alpha
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033093, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCTGGAATCCTGGTTAATGTAAAGGAGGAGGTGACCTGCCCCATCTGCCTGGAACTCCTGACAC
  AACCCCTGAGCCTGGACTGCGGCCACAGCTTCTGCCAAGCATGCCTCACTGCAAACCACAAGAAGTCCAT
  GCTAGACAAAGGAGAGAGTAGCTGCCCTGTGTGCCGGATCAGTTACCAGCCTGAGAACATACGGCCTAAT
  CGGCATGTAGCCAACATAGTGGAGAAGCTCAGGGAGGTCAAGTTGAGCCCAGAGGGGCAGAAAGTTGATC
  ATTGTGCACGCCATGGAGAGAAACTTCTACTCTTCTGTCAGGAGGACGGGAAGGTCATTTGCTGGCTTTG
  TGAGCGGTCTCAGGAGCACCGTGGTCACCACACGTTCCTCACAGAGGAGGTTGCCCGGGAGTACCAAGTG
  AAGCTCCAGGCAGCTCTGGAGATGCTGAGGCAGAAGCAGCAGGAAGCTGAAGAGTTAGAAGCTGACATCA
  GAGAAGAGAAAGCTTCCTGGAAGACTCAAATACAGTATGACAAAACCAACGTCTTGGCAGATTTTGAGCA
  ACTGAGAGACATCCTGGACTGGGAGGAGAGCAATGAGCTGCAAAACCTGGAGAAGGAGGAGGAAGACATT
  CTGAAAAGCCTTACGAACTCTGAAACTGAGATGGTGCAGCAGACCCAGTCCCTGAGAGAGCTCATCTCAG
  ATCTGGAGCATCGGCTGCAGGGGTCAGTGATGGAGCTGCTTCAGGGTGTGGATGGCGTCATAAAAAGGAC
  GGAGAACGTGACCTTGAAGAAGCCAGAAACTTTTCCAAAAAATCAAAGGAGAGTGTTTCGAGCTCCTGAT
  CTGAAAGGAATGCTAGAAGTGTTTAGAGAGCTGACAGATGTCCGACGCTACTGGGGCTGGAGTGCAATGG
  CACGATCTCGGTTCACTGCAACCTCCACCTCTCAGATTCAAGCAATTCTCCTGCCTCAGCCTCCCAAGTA
  G
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033093
• ORF Size: 981 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_033093.2, NP_149084.2
• RefSeq Size: 2029
• RefSeq ORF: 981
• Locus ID: 85363
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein forms homo-oligomers via the coilel-coil region and localizes to cytoplasmic bodies. It appears to function as a E3 ubiquitin-ligase and ubiqutinates itself to regulate its subcellular localization. It may play a role in retroviral restriction. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (delta) differs in the 5' UTR and uses an alternate splice site in the 3' terminal exon, which results in a frameshift, compared to variant alpha. The encoded isoform (delta) has a shorter and distinct C-terminus, compared to isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.