MEIS2 (NM_172315) Human Untagged Clone

CAT#: SC313254

MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant g


  "NM_172315" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MEIS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MEIS2
Synonyms CPCMR; HsT18361; MRG1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_172315, the custom clone sequence may differ by one or more nucleotides
ATGGACGGAGTAGGGGTTCCCGCTTCCATGTACGGAGACCCTCACGCGCCGCGGCCGATC
CCCCCGGTTCACCACCTGAACCACGGGCCGCCGCTCCACGCCACACAGCACTACGGCGCG
CACGCCCCGCACCCCAATGTCATGCCGGCCAGTATGGGATCCGCTGTCAACGACGCCTTG
AAGCGGGACAAGGACGCGATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTCTTT
GAGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCTGGAGTGGCTGGCGGAGACGTC
TGCTCCTCCGACTCCTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAA
AAGCCACTTTTTTCCTCAAATCCAGAGCTGGACAATTTGATGATACAAGCAATACAAGTA
CTAAGGTTTCATCTTTTGGAGTTAGAAAAGGTCCACGAACTGTGCGATAACTTCTGCCAC
CGATACATTAGCTGTTTGAAGGGGAAAATGCCCATCGACCTCGTCATTGATGAAAGAGAC
GGCAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACAAATCTCGCTGACCAT
AACCCTTCTTCTTGGCGAGACCACGATGATGCAACCTCAACCCACTCAGCAGGCACCCCA
GGGCCCTCCAGTGGGGGCCATGCTTCCCAGAGCGGAGACAACAGCAGTGAGCAAGGGGAT
GGTTTAGACAACAGTGTAGCTTCACCTGGTACAGGTGACGATGATGATCCGGATAAGGAC
AAAAAACGCCAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACAAATATCATGAGAGCA
TGGCTCTTCCAGCATCTCACACATCCGTACCCTTCCGAAGAGCAGAAGAAACAGTTAGCG
CAAGACACAGGACTTACAATTCTCCAAGTAAACAACTGGTTTATTAATGCCAGAAGAAGA
ATAGTACAGCCCATGATTGACCAGTCAAATCGAGCAGGTTTTCTTCTTGATCCTTCAGTG
AGCCAAGGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGT
CAGCAACACATGGGGATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGC
ATGGATGGGCAATGGCACTACATG
Restriction Sites Please inquire     
ACCN NM_172315
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172315.1, NP_758526.1
RefSeq Size 2775 bp
RefSeq ORF 1167 bp
Locus ID 4212
Cytogenetics 15q14
Protein Families Transcription Factors
Gene Summary 'This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (g) differs in the 5' UTR and coding sequence compared to variant a. The resulting isoform (g) has a shorter N-terminus when compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.