Dystrobrevin alpha (DTNA) (NM_032980) Human Untagged Clone

CAT#: SC313269

DTNA (untagged)-Human dystrobrevin, alpha (DTNA), transcript variant 6


  "NM_032980" in other vectors (6)

Reconstitution Protocol

USD 670.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DTNA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DTNA
Synonyms D18S892E; DRP3; DTN; DTN-A; LVNC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_032980, the custom clone sequence may differ by one or more nucleotides


ATGTTCCCAGATCAGCCTGAGAAGCCACTCAACTTGGCTCACATCGTGCCTCCCAGACCTGTAACCAGCA
TGAACGACACCCTGTTCTCCCACTCTGTTCCCTCCTCAGGAAGTCCTTTTATTACCAGGAGCTCTCCTCC
CAAGGACAGTGAAGTAGAGCAGAACAAACTGCTGGCTAGGGCTGCTCCAGCTTTTCTGAAGGGCAAAGGC
ATGCTTGAGAGTTCAAACCGGCTTGATGAAGAACACAGGCTAATTGCCAGGTATGCGGCAAGGCTGGCAG
CAGAGTCCTCTTCGTCTCAGCCACCTCAGCAGAGAAGTGCTCCTGACATCTCTTTCACCATCGATGCGAA
TAAGCAGCAAAGGCAGCTGATTGCTGAGCTAGAAAACAAGAACAGAGAAATCTTACAGGAGATCCAGAGA
CTTCGGCTAGAGCATGAACAAGCTTCTCAGCCCACGCCAGAGAAGGCACAGCAAAACCCCACCCTGCTGG
CAGAACTCCGGCTCCTCAGACAGCGCAAAGATGAGCTGGAACAGAGAATGTCTGCTCTCCAGGAGAGCCG
GAGAGAGCTAATGGTCCAGTTGGAGGGTCTCATGAAGCTACTAAAGACTCAGGGGGCAGGCTCTCCCCGC
TCCTCCCCCAGCCACACCATCAGCAGGCCAATTCCCATGCCCATCCGGTCAGCGTCAGCCTGCTCCACCC
CGACGCACACGCCGCAGGACTCCCTCACAGGAGTAGGGGGAGATGTACAAGAGGCATTTGCACAAAGTTC
AAGAAGAAACTTAAGGAATGACTTGCTAGTGGCTGCAGATTCCATCACTAACACTATGTCCTCTCTTGTG
AAAGAGCTGAATTCTGAGGTTGGGAGTGAAACAGAGAGTAATGTGGATTCTGAATTTGCACGGACTCAGT
TTGAGGATCTTGTTCCCTCACCAACCTCTGAAAAGGCTTTTCTAGCGCAAATCCATGCCCGAAAACCTGG
GTACATTCACAGTGGAGCTACCACAAGTACCATGCGTGGCGACATGGTTACGGAGGATGCAGATCCCTAT
GTGCAGCCTGAAGATGAAAACTATGAAAATGACTCTGTCCGGCAGCTGGAGAATGAGCTCCAGATGGAGG
AATACCTGAAACAGAAGCTGCAAGATGAAGCTTATCAGGTCAGCTTGCAAGGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_032980
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032980.3, NP_116762.2
RefSeq Size 5689 bp
RefSeq ORF 1176 bp
Locus ID 1837
Cytogenetics 18q12.1
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (6), also known as epsilon transcript, lacks two in-frame coding exons and multiple exons from the 5' end, and contains an alternate 5' exon, compared to transcript variant 1. This results in an isoform (6) with a much shorter N-terminus and missing two internal segments, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.