AAMP (NM_001087) Human Untagged Clone
CAT#: SC313447
AAMP (untagged)-Human angio-associated, migratory cell protein (AAMP)
"NM_001087" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AAMP |
Synonyms | angio-associated, migratory cell protein |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001087, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCCGAATCGGAAAGCGGGGCTGCTGCTGACACCCCCCCACTGGAGACCCTAAGCTTCCATGGTG ATGAAGAGATTATCGAGGTGGTAGAACTTGATCCCGGTCCGCCGGACCCAGATGACCTGGCCCAGGAGAT GGAAGATGTGGACTTTGAGGAAGAAGAGGAGGAAGAGGGCAACGAAGAGGGCTGGGTTCTAGAACCCCAG GAAGGGGTGGTCGGCAGCATGGAGGGCCCCGACGATAGCGAGGTCACCTTTGCATTGCACTCAGCATCTG TGTTTTGTGTGAGCCTGGACCCCAAGACCAATACCTTGGCAGTGACCGGGGGTGAAGATGACAAAGCCTT CGTATGGCGGCTCAGCGATGGGGAGCTGCTCTTTGAGTGTGCAGGCCATAAAGACTCTGTGACTTGTGCT GGTTTCAGCCATGACTCCACTCTAGTGGCCACAGGGGACATGAGTGGCCTCTTGAAAGTGTGGCAGGTGG ACACTAAGGAGGAGGTCTGGTCCTTTGAAGCGGGAGACCTGGAGTGGATGGAGTGGCATCCTCGGGCACC TGTCCTGTTGGCGGGCACAGCTGACGGCAACACCTGGATGTGGAAAGTCCCGAATGGTGACTGCAAGACC TTCCAGGGTCCCAACTGCCCAGCCACCTGTGGCCGAGTCCTCCCTGATGGGAAGAGAGCTGTGGTAGGCT ATGAAGATGGGACCATCAGGATTTGGGACCTGAAGCAGGGAAGCCCTATCCATGTACTGAAAGGGACTGA GGGTCACCAGGGCCCACTCACCTGTGTTGCTGCCAACCAGGATGGCAGCTTGATCCTAACTGGCTCTGTG GACTGCCAGGCCAAGCTGGTCAGTGCCACCACCGGCAAGGTGGTGGGTGTTTTTAGACCTGAGACTGTGG CCTCCCAGCCCAGCCTGGGAGAAGGGGAGGAGAGTGAGTCCAACTCGGTGGAGTCCTTGGGCTTCTGCAG TGTGATGCCCCTGGCAGCTGTTGGCTACCTGGATGGGACCTTGGCCATCTATGACCTGGCTACGCAGACT CTTAGGCATCAGTGTCAGCACCAGTCGGGCATCGTGCAGCTGCTGTGGGAGGCAGGCACTGCCGTGGTAT ATACCTGCAGCCTGGATGGCATCGTGCGCCTCTGGGACGCCCGGACCGGCCGCCTGCTTACTGACTACCG GGGCCACACGGCTGAGATCCTGGACTTTGCCCTCAGCAAAGATGCCTCCCTGGTGGTGACCACGTCAGGA GACCACAAAGCGAAAGTATTTTGTGTCCAAAGGCCTGACCGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001087 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001087.4, NP_001078.2 |
RefSeq Size | 1842 bp |
RefSeq ORF | 1305 bp |
Locus ID | 14 |
Cytogenetics | 2q35 |
Domains | WD40 |
Gene Summary | 'The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]' Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218474 | AAMP (Myc-DDK-tagged)-Human angio-associated, migratory cell protein (AAMP) |
USD 420.00 |
|
RG218474 | AAMP (GFP-tagged) - Human angio-associated, migratory cell protein (AAMP) |
USD 460.00 |
|
RC218474L3 | Lenti ORF clone of Human angio-associated, migratory cell protein (AAMP), Myc-DDK-tagged |
USD 620.00 |
|
RC218474L4 | Lenti ORF clone of Human angio-associated, migratory cell protein (AAMP), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review