HNT (NTM) (NM_001048209) Human Untagged Clone
CAT#: SC315421
NTM (untagged)-Human neurotrimin (NTM), transcript variant 2
"NM_001048209" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NTM |
Synonyms | CEPU-1; HNT; IGLON2; NTRI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001048209, the custom clone sequence may differ by one or more nucleotides
ATGAAAACCATCCAGCCAAAAATGCACAATTCTATCTCTTGGGCAATCTTCACGGGGCTGGCTGCTCTGT GTCTCTTCCAAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACGGT CCGGCAGGGGGAGAGCGCCACCCTCAGGTGCACTATTGACAACCGGGTCACCCGGGTGGCCTGGCTAAAC CGCAGCACCATCCTCTATGCTGGGAATGACAAGTGGTGCCTGGATCCTCGCGTGGTCCTTCTGAGCAACA CCCAAACGCAGTACAGCATCGAGATCCAGAACGTGGATGTGTATGACGAGGGCCCTTACACCTGCTCGGT GCAGACAGACAACCACCCAAAGACCTCTAGGGTCCACCTCATTGTGCAAGTATCTCCCAAAATTGTAGAG ATTTCTTCAGATATCTCCATTAATGAAGGGAACAATATTAGCCTCACCTGCATAGCAACTGGTAGACCAG AGCCTACGGTTACTTGGAGACACATCTCTCCCAAAGCGGTTGGCTTTGTGAGTGAAGACGAATACTTGGA AATTCAGGGCATCACCAGGGAGCAGTCAGGGGACTACGAGTGCAGTGCCTCCAATGACGTGGCCGCGCCC GTGGTACGGAGAGTAAAGGTCACCGTGAACTATCCACCATACATTTCAGAAGCCAAGGGTACAGGTGTCC CCGTGGGACAAAAGGGGACACTGCAGTGTGAAGCCTCAGCAGTCCCCTCAGCAGAATTCCAGTGGTACAA GGATGACAAAAGACTGATTGAAGGAAAGAAAGGGGTGAAAGTGGAAAACAGACCTTTCCTCTCAAAACTC ATCTTCTTCAATGTCTCTGAACATGACTATGGGAACTACACTTGCGTGGCCTCCAACAAGCTGGGCCACA CCAATGCCAGCATCATGCTATTTGGTCCAGGCGCCGTCAGCGAGGTGAGCAACGGCACGTCGAGGAGGGC AGGCTGCGTCTGGCTGCTGCCTCTTCTGGTCTTGCACCTGCTTCTCAAATTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001048209 |
ORF Size | 1035 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001048209.1, NP_001041674.1 |
RefSeq Size | 3048 |
RefSeq ORF | 1035 |
Locus ID | 50863 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the IgLON (LAMP, OBCAM, Ntm) family of immunoglobulin (Ig) domain-containing glycosylphosphatidylinositol (GPI)-anchored cell adhesion molecules. The encoded protein may promote neurite outgrowth and adhesion via a homophilic mechanism. This gene is closely linked to a related family member, opioid binding protein/cell adhesion molecule-like (OPCML), on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (2) differs in the 5' UTR and in the coding region compared to variant 3, resulting in a protein that maintains the reading frame but is shorter and has a distinct N-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213369 | NTM (Myc-DDK-tagged)-Human neurotrimin (NTM), transcript variant 2 |
USD 420.00 |
|
RG213369 | NTM (GFP-tagged) - Human neurotrimin (NTM), transcript variant 2 |
USD 460.00 |
|
RC213369L1 | Lenti ORF clone of Human neurotrimin (NTM), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC213369L2 | Lenti ORF clone of Human neurotrimin (NTM), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC213369L3 | Lenti ORF clone of Human neurotrimin (NTM), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC213369L4 | Lenti ORF clone of Human neurotrimin (NTM), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review