HNT (NTM) (NM_001048209) Human Untagged Clone

CAT#: SC315421

NTM (untagged)-Human neurotrimin (NTM), transcript variant 2


  "NM_001048209" in other vectors (6)

Reconstitution Protocol

USD 590.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NTM
Synonyms CEPU-1; HNT; IGLON2; NTRI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001048209, the custom clone sequence may differ by one or more nucleotides


ATGAAAACCATCCAGCCAAAAATGCACAATTCTATCTCTTGGGCAATCTTCACGGGGCTGGCTGCTCTGT
GTCTCTTCCAAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACGGT
CCGGCAGGGGGAGAGCGCCACCCTCAGGTGCACTATTGACAACCGGGTCACCCGGGTGGCCTGGCTAAAC
CGCAGCACCATCCTCTATGCTGGGAATGACAAGTGGTGCCTGGATCCTCGCGTGGTCCTTCTGAGCAACA
CCCAAACGCAGTACAGCATCGAGATCCAGAACGTGGATGTGTATGACGAGGGCCCTTACACCTGCTCGGT
GCAGACAGACAACCACCCAAAGACCTCTAGGGTCCACCTCATTGTGCAAGTATCTCCCAAAATTGTAGAG
ATTTCTTCAGATATCTCCATTAATGAAGGGAACAATATTAGCCTCACCTGCATAGCAACTGGTAGACCAG
AGCCTACGGTTACTTGGAGACACATCTCTCCCAAAGCGGTTGGCTTTGTGAGTGAAGACGAATACTTGGA
AATTCAGGGCATCACCAGGGAGCAGTCAGGGGACTACGAGTGCAGTGCCTCCAATGACGTGGCCGCGCCC
GTGGTACGGAGAGTAAAGGTCACCGTGAACTATCCACCATACATTTCAGAAGCCAAGGGTACAGGTGTCC
CCGTGGGACAAAAGGGGACACTGCAGTGTGAAGCCTCAGCAGTCCCCTCAGCAGAATTCCAGTGGTACAA
GGATGACAAAAGACTGATTGAAGGAAAGAAAGGGGTGAAAGTGGAAAACAGACCTTTCCTCTCAAAACTC
ATCTTCTTCAATGTCTCTGAACATGACTATGGGAACTACACTTGCGTGGCCTCCAACAAGCTGGGCCACA
CCAATGCCAGCATCATGCTATTTGGTCCAGGCGCCGTCAGCGAGGTGAGCAACGGCACGTCGAGGAGGGC
AGGCTGCGTCTGGCTGCTGCCTCTTCTGGTCTTGCACCTGCTTCTCAAATTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001048209
ORF Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001048209.1, NP_001041674.1
RefSeq Size 3048
RefSeq ORF 1035
Locus ID 50863
Protein Families Transmembrane
Gene Summary This gene encodes a member of the IgLON (LAMP, OBCAM, Ntm) family of immunoglobulin (Ig) domain-containing glycosylphosphatidylinositol (GPI)-anchored cell adhesion molecules. The encoded protein may promote neurite outgrowth and adhesion via a homophilic mechanism. This gene is closely linked to a related family member, opioid binding protein/cell adhesion molecule-like (OPCML), on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and in the coding region compared to variant 3, resulting in a protein that maintains the reading frame but is shorter and has a distinct N-terminus, compared to isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.