LYPD1 (NM_001077427) Human Untagged Clone

CAT#: SC315466

LYPD1 (untagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LYPD1
• Synonyms: LYPDC1; PHTS
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001077427 edited
  ATGTGTCAGAAAGAAGTGATGGAGCAAAGTGCCGGGATCATGTACCGCAAGTCCTGTGCA
  TCATCAGCGGCCTGTCTCATCGCCTCTGCCGGGTACCAGTCCTTCTGCTCCCCAGGGAAA
  CTGAACTCAGTTTGCATCAGCTGCTGCAACACCCCTCTTTGTAACGGGCCAAGGCCCAAG
  AAAAGGGGAAGTTCTGCCTCGGCCCTCAGGCCAGGGCTCCGCACCACCATCCTGTTCCTC
  AAATTAGCCCTCTTCTCGGCACACTGCTGA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001077427
• ORF Size: 270 bp
• Insert Size: 1600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001077427.2.

Reference Data

• RefSeq: NM_001077427.1, NP_001070895.1
• RefSeq Size: 1814
• RefSeq ORF: 270
• Locus ID: 116372
• Protein Families: Druggable Genome, Transmembrane