TAC4 (NM_001077503) Human Untagged Clone

CAT#: SC315467

TAC4 (untagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant beta


  "NM_001077503" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAC4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAC4
Synonyms EK; HK-1; HK1; PPT-C
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001077503, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCTTGCCTCGCCCTGCTTCTCCTGATGGAGCTGTCCGTGTGCACTGTGGCAGGT
GATGGTGGAGAGGAACAGACACTCAGCACTGAAGCAGAGACCTGGGAAGGCGCTGGCCCC
AGCATTCAGCTCCAGCTGCAGGAGGTGAAGACGGGCAAGGCAAGCCAGTTCTTTGGGCTG
ATGGGGAAGCGAGTGGGAGCATATCAGCTGGAACACACGTTCCAGGGCCTCCTGGGCAAG
AGAAGCCTGTTCACAGAAGGCAGAGAGGATGAGGCCCAAGGTTCAGAG
Restriction Sites Please inquire     
ACCN NM_001077503
ORF Size 291 bp
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001077503.1, NP_001070971.1
RefSeq Size 624
RefSeq ORF 291
Locus ID 255061
Gene Summary This gene is a member of the tachykinin family of neurotransmitter-encoding genes. Tachykinin proteins are cleaved into small, secreted peptides that activate members of a family of receptor proteins. The products of this gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The products of this gene lack a dibasic cleavage site found in other tachykinin proteins. Consequently, the nature of the cleavage products generated in vivo remains to be determined. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (beta) uses an alternate in-frame splice site in the 5' coding region and skips an alternate in-frame exon in the 3' coding region, compared to variant alpha. The resulting protein (isoform beta) is shorter than isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.