Probable hydrolase PNKD (PNKD) (NM_001077399) Human Untagged Clone

CAT#: SC315476

PNKD (untagged)-Human paroxysmal nonkinesigenic dyskinesia (PNKD), nuclear gene encoding mitochondrial protein, transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PNKD
• Synonyms: BRP17; DYT8; FKSG19; FPD1; KIPP1184; MR-1; MR-1S; MR1; PDC; PKND1; PNKD1; TAHCCP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001077399, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGCGGTGGTAGCTGCTACGGCGCTGAAGGGCCGGGGGGCGAGAAATGCCCGCGTC
  CTCCGGGGGATTCTCGCAGGAGCCACAGCTAACAAGGCTTCTCATAACAGGACCCGGGCC
  CTGCAAAGCCACAGCTCCCCAGAGGGCAAGGAGGAACCTGAACCCCTATCCCCGGAGCTG
  GAATACATTCCCAGAAAGAGGGGCAAGAACCCCATGAAAGCTGTGGGACTGGCCTGGGCC
  ATCGGCTTCCCTTGTGGTATCCTCCTCTTCATCCTCACCAAGCGGGAAGTGGACAAGGAC
  CGTGTGAAGCAGATGAAGGCTCGGCAGAACATGCGGTTGTCCAACACGGGCGAGTATGAG
  AGCCAGAGGTTCAGGGCTTCCTCCCAGAGTGCCCCGTCCCCTGATGTTGGGTCTGGGGTG
  CAGACC
  
• Restriction Sites: Please inquire
• ACCN: NM_001077399
• ORF Size: 429 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001077399.1, NP_001070867.1
• RefSeq Size: 756
• RefSeq ORF: 429
• Locus ID: 25953
• Protein Families: Transmembrane
• Gene Summary: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (3), alternately referred to as the short form (MR-1S), differs in the 3' UTR and has multiple coding region differences, compared to variant 1. This results in a frameshift in isoform 3, which has a distinct C-terminus and is shorter than isoform 1.