ECSCR (NM_001077693) Human Untagged Clone

CAT#: SC315488

ECSCR (untagged)-Human endothelial cell-specific chemotaxis regulator (ECSCR)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ECSCR
• Synonyms: ARIA; ECSM2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001077693, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCACCGCAGGAGCCATGCAGCTGTGCTGGGTGATCCTGGGCTTCCTCCTGTTCCGAGGCCACAACT
  CCCAGCCCACAATGACCCAGACCTCTAGCTCTCAGGGAGGCCTTGGCGGTCTAAGTCTGACCACAGAGCC
  AGTTTCTTCCAACCCAGGATACATCCCTTCCTCAGAGGCTAACAGGCCAAGCCATCTGTCCAGCACTGGT
  ACCCCAGGCGCAGGTGTCCCCAGCAGTGGAAGAGACGGAGGCACAAGCAGAGACACATTTCAAACTGTTC
  CCCCCAATTCAACCACCATGAGCCTGAGCATGAGGGAAGATGCGACCATCCTGCCCAGCCCCACGTCAGA
  GACTGTGCTCACTGTGGCTGCATTTGGTGTTATCAGCTTCATTGTCATCCTGGTGGTTGTGGTGATCATC
  CTAGTTGGTGTGGTCAGCCTGAGGTTCAAGTGTCGGAAGAGCAAGGAGTCTGAAGATCCCCAGAAACCTG
  GGAGTTCAGGGCTGTCTGAAAGCTGCTCCACAGCCAATGGAGAGAAAGACAGCATCACCCTTATCTCCAT
  GAAGAACATCAACATGAATAATGGCAAACAAAGTCTCTCAGCAGAGAAGGTTCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001077693
• ORF Size: 618 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001077693.3, NP_001071161.1
• RefSeq Size: 1051
• RefSeq ORF: 618
• Locus ID: 641700
• Gene Summary: The protein encoded by this gene is primarily found in endothelial cells and blood vessels, where it is involved in cell shape changes and EGF-induced cell migration. It can enhance the activation of vascular endothelial growth factor receptor-2/kinase insert domain receptor and also promote the proteolysis of internalized kinase insert domain receptor. This gene may play a role in angiogenesis-related diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
  Transcript Variant: This variant (1) encodes the longer isoform (1).