RTBDN (NM_001080997) Human Untagged Clone
CAT#: SC315930
RTBDN (untagged)-Human retbindin (RTBDN), transcript variant 1
"NM_001080997" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RTBDN |
Synonyms | FLJ36353 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001080997, the custom clone sequence may differ by one or more nucleotides
ATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACGTGGGTGCTGCAACTGACCTTGGCATGGATCC TGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCCAGGTCCCAGCAACACCATGGGCTGGCAGCTGA TCTGGGCAAAGGCAAGCTGCACCTGGCAGGACCTTGTTGTCCCTCAGAGATGGACACAACAGAGACATCG GGCCCTGGAAACCATCCAGAACGCTGTGGAGTGCCGAGCCCTGAATGCGAATCCTTCCTGGAACACCTCC AACGTGCCCTTCGCAGTCGCTTCCGCCTGCGGCTATTGGGGGTACGCCAGGCACAGCCGCTCTGCGAGGA GCTCTGCCAGGCCTGGTTCGCCAACTGCGAAGATGATATCACCTGCGGCCCGACTTGGCTCCCACTCTCA GAAAAAAGGGGCTGTGAGCCCAGCTGCCTTACCTATGGACAGACCTTCGCAGACGGGACGGACCTTTGTC GCTCGGCTCTGGGCCACGCCCTACCGGTGGCTGCTCCTGGAGCCCGTCACTGCTTCAACATCTCCATCTC CGCGGTACCTCGTCCCAGACCAGGACGACGGGGCCGGGAAGCTCCCTCCCGGCGTTCCCGCAGCCCTCGC ACCTCCATCCTGGACGCTGCGGGCAGCGGGAGTGGCAGTGGAAGCGGCAGCGGCCCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080997 |
ORF Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001080997.2, NP_001074466.1 |
RefSeq Size | 1089 |
RefSeq ORF | 690 |
Locus ID | 83546 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) encodes isoform (1). Variants 1, 6 and 7 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218302 | RTBDN (Myc-DDK-tagged)-Human retbindin (RTBDN), transcript variant 1 |
USD 420.00 |
|
RG218302 | RTBDN (GFP-tagged) - Human retbindin (RTBDN), transcript variant 1 |
USD 460.00 |
|
RC218302L3 | Lenti ORF clone of Human retbindin (RTBDN), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC218302L4 | Lenti ORF clone of Human retbindin (RTBDN), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review