GPR34 (NM_001097579) Human Untagged Clone

CAT#: SC316196

GPR34 (untagged)-Human G protein-coupled receptor 34 (GPR34), transcript variant 4


  "NM_001097579" in other vectors (6)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GPR34"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GPR34
Synonyms LYPSR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001097579, the custom clone sequence may differ by one or more nucleotides


ATGAGAAGTCATACCATAACAATGACGACAACTTCAGTCAGCAGCTGGCCTTACTCCTCCCACAGAATGC
GCTTTATAACCAATCATAGCGACCAACCGCCACAAAACTTCTCAGCAACACCAAATGTTACTACCTGTCC
CATGGATGAAAAATTGCTATCTACTGTGTTAACCACATCCTACTCTGTTATTTTCATCGTGGGACTGGTT
GGGAACATAATCGCCCTCTATGTATTTCTGGGTATTCACCGTAAAAGAAATTCCATTCAAATTTATCTAC
TTAACGTAGCCATTGCAGACCTCCTACTCATCTTCTGCCTCCCTTTCCGAATAATGTATCATATTAACCA
AAACAAGTGGACACTAGGTGTGATTCTGTGCAAGGTTGTGGGAACACTGTTTTATATGAACATGTACATT
AGCATTATTTTGCTTGGATTCATCAGTTTGGATCGCTATATAAAAATTAATCGGTCTATACAGCAACGGA
AGGCAATAACAACCAAACAAAGTATTTATGTCTGTTGTATAGTATGGATGCTTGCTCTTGGTGGATTCCT
AACTATGATTATTTTAACACTTAAGAAAGGAGGGCATAATTCCACAATGTGTTTCCATTACAGAGATAAG
CATAACGCAAAAGGAGAAGCCATTTTTAACTTCATTCTTGTGGTAATGTTCTGGCTAATTTTCTTACTAA
TAATCCTTTCATATATTAAGATTGGGAAGAATCTATTGAGGATTTCTAAAAGGAGGTCAAAATTTCCTAA
TTCTGGTAAATATGCCACTACAGCTCGTAACTCCTTTATTGTACTTATCATTTTTACTATATGTTTTGTT
CCCTATCATGCCTTTCGATTCATCTACATTTCTTCACAGCTAAATGTATCATCTTGCTACTGGAAAGAAA
TTGTTCACAAAACCAATGAGATCATGCTGGTTCTCTCATCTTTCAATAGTTGCTTAGATCCAGTCATGTA
TTTCCTGATGTCCAGTAACATTCGCAAAATAATGTGCCAACTTCTTTTTAGACGATTTCAAGGTGAACCA
AGTAGGAGTGAAAGCACTTCAGAATTTAAACCAGGATACTCCCTGCATGATACATCTGTGGCAGTGAAAA
TACAGTCTAGTTCTAAAAGTACTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001097579
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001097579.1, NP_001091048.1
RefSeq Size 1938 bp
RefSeq ORF 1146 bp
Locus ID 2857
Cytogenetics Xp11.4
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary 'G protein-coupled receptors (GPCRs), such as GPR34, are integral membrane proteins containing 7 putative transmembrane domains (TMs). These proteins mediate signals to the interior of the cell via activation of heterotrimeric G proteins that in turn activate various effector proteins, ultimately resulting in a physiologic response.[supplied by OMIM, Apr 2006]'
Transcript Variant: This variant (4) represents the longer transcript. Both variants 1 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.